Sorex_araneus Locus Mono:844:SNORA70
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:844:SNORA70
Sorex_araneus
Mono:844:SNORA70
GeneScaffold_6943
SNORA70
1001..1123
2123
TGTATGAGGGAAACATGAGCATGAAAATGTATAAATCTGTAACTGTACCCTCACGGTGA
CTCACTAATTAAAAATAAATTAATTAAAAAAAAAGAACTTGTTCATTGACCATAGCTCTG
AACCATTTCCAATCATCCTAGGATCAAAATAAATGTTCTTGCTTGTTTATGTGCGACATC
CAGCAGTGCTCAGGGGGCTACTCCCAGCTCAGCACATAGGGGTTACTCCCAGCAGTGCTT
AGGGACCATGTGGTCTGGGAATTGAACCGGGTGACCAGCATGTGAAGCGTGTGCTCTAAC
CCACTGAGATAGCTCTCTGGCCTGGATTGGAATAATTTTTCACTAGATTCCTTGAAGTTT
TTCTGCACCTTGCAGACTATTTATCATCGGAATCATCATTACATGTAGTCATTTGCCGGA
AGTACTGGAACATTCAGAATTTAATTTGCAGTCAAGGAGTTTTGCTTGGACTTTTGTCAT
GACGTATTCAAATTTGGAGTCATTTTTGTTGTTTTTTGTTTTAGGGCCACACCCAGTGGT
GTTCAGGGCTTGCTATTGGCTCTGTGATCAGGGATCACTCCTGGCCGGCTTGAGGGCAAT
ATTCGATGCCAGGGATTGAACCTGGGTCAGTCTCATGCAAGGCAAGCACTCTACCACTGT
ACTATTGTTCTGGCCCACAAATCTGGAATCTTTGTGAGTTAAGGGAGGTTTCCAGTTTAT
TTTGCCTCATATGAGAATGTCACAGTTTTCATGAGTAACAAAAGACACCATTGAGCATAT
CATCATCGGGTACGAATGAAATAACTGCCCTGATTGATAGAAAGGTCCAGGCACATGCAT
TGCTAGAGTTGCATCTTACACCTTTCAGGTAGTAAAAATGAAATGTAACCAAAGTTGTCT
GCCTTTTCCTCACGGTGGACACTGCCTGATGCGAGGAGAGTGGGGTTTGCAGAGGAGAAA
AGGTTCAGGTGTTCTTCTGCCTGCAGATCAGAGTTGTTCAGGTGTGGCCAATTAAGCCAA
CTGTGCTCCCTGCCCTGTGGGGCCCTGTGTGCAATGGCAGCAAACAGCCTTCTCAGTAGT
GTTCACGGCCTATGGCTTGGATGGGCTGTAATAAGGAGACAGTTCTTTGCTGTGGACATT
CATATCTGCTTTTCTACCAGCCCCAACTTCAGGCTTCAAACGGCATAAGAAACATGTGAT
TGAGGCTCTGCGCTGGGCTAAGTTCAAGTTTCCCGGTCGCCAGAAAATCCACATATCCCA
GGGGAAGGGACTTTACTAAGTTGTTTTTTTTTTCTTTTTGGGTCACACCTGGCGATGCAC
AGGTTACTTCTGGCTCTGCACTCCAGAATTACCCCTGGCAGTGCTCAGAGGACCATATGG
GTTGCTGGGAATTGAACCCGACTCGGCCGCGTGCAAGGCAAACCCCCCACCCGCTGTGCT
ATCGCTCCAGCCGGACTTTGCCAAGTTTAATGTGAATGAGTTTGAAGACATGGTGGCCGA
GAAGCAGTTCATCCCAGATGACCGTAGGGCCAAATACATCTCCAATCATGAGCCTCTGGA
CAAATGCTGGGCACTGCACTTGGGTCTGCTTCTTCAGTCCCTGCTCACAACCACCCCATC
CTCCCAACCACAATAAATCCTGCTTCTTAACCAAAAAAAGAAAGGGAAAGGAAAGAAAAA
CAGAGTTGCTTTTGGTTTACTTCAAATTCCTTCTCCACAGTCCAAGGAGCACTTGCATTT
GGAACAAAAATGTTTTCTCAGCAGCAGCTGCCAACAAATATTTCCTGCTTGATGCCAGCG
CTCTGGCATCACTGAAAAAAATAATGACAACTATGTAAAATGGCCCTATGCAAATATAAA
CATTGCCTTGCTTATCTGCTATCTTTTGGCAACTTTTGCTGTTTGGTTTCCTTGGAGGAC
CTGTATCTTTTCCTAAAGGCAAAAAATGAAGTGTTCTTCTTTATGGACATTGCACATCTA
TTAAGCATAAAGCATATCTTCCTCTTTTTTTTTTTTTTTGGCTTTTTGGGTCACACCCAG
CGATGCACAGGGGTTACTCCTGGCTCTGCACTCAGGAATTACCCTTGGCGGTGCTCAGGG
GACCATATGGGATGCTGGGAATCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved