Sorex_araneus Locus Mono:764:SNORD83
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:764:SNORD83
Sorex_araneus
Mono:764:SNORD83
GeneScaffold_7064
SNORD83
1001..1078
1956
CCGGAGTGCGCGGAACTATAAACGGCGGAAGGTCCCGCTTCCTGTGTTCCTTGCGCCTG
CGCATTGGCAGGCAAGAAGGCGGGAAGCCGAGAAGAGGGAAGCCGGGAACCGGAAGTGAA
TGTAGATTTCCCTCCTTCGTCCCTGCTGCCGCCGCCATACGTACTCGTCTTGCTCAGGTA
AGGTCTGGCCTTCGGGACCATCCGCCTCCATCTCCGTTTCTCTCGGGTCATCCCGTCTCT
TGGGCTCCTAATACCCGTTCTACAGGTTATAGTCTCATCCCTGACGTCTAGTTGGGTTGT
TTCCATTGCTCTTTCCCTTTGCGGCAGCAAAGAACTCCTGAGGGGGGAGGTAGGGCCGCT
GGCGCGGAGGTGGGGGAAGCGATTCAAAATGGTGGCCCGGGCGCCATTGTGTTTCTTTTG
CGCTCGTCATCCGCATCGGGCCTCTCGTTTCGCTGAGGCACCAGCGATGCGGCGGCGCTG
GGCGTCCGTGGCCCTGGACTTCGGCGGAGGGCGAGGCCCTTCGCCTGCCTCTTGCCTCTG
GGCGCCCATCGGTCGAGCCGGTTGCTCGGCCGCGCTCGGCCGCGCTCGCTCGCCCCGTGT
GGGGCCCGTTTCCAAACGTTCACGATCGGGCTCCTGTGTGCTCTCGGGGAAGGAGGCGCC
TGGAGTAGTGCCGGGGAAACGGTAGAGGGCCAGTTAGCTGCAGTGGAGAATCGGGGCCGC
TTCTTCGTTTCCTTGTTCCCGCGAGAAAGGGAACACAAACAAACAAACAAGAAACAGTTG
TTTTTGTCGCTGAGTCACGGCTCCCGCACCTCCGCGTTCCTCATCAGTCGCCCCGGGCTT
TCCGACCCCGGCGGGAGGGTCTCCGGGCGGGGGGCGGCAGCCACATGATGTTCGCTTCTT
GAGAAATGAGCGCTTGGCGCAATGCTGACCATTATCTATCACCCTGGACTGATGGCTGCT
GCCCGAGGCAACGGGGACCGCGCGGGGTCTTTGAAGGGGTCTCACAGGCCCTTTCTTCCT
CCTCCTCCTCTCCGTCCTCCGCCTCTGCGTTTCACTATCTCCTCTTCCCGCATCGTTGTT
TGCAGATCAGGAATGTACAAGTTAGTCTTCCGCAATATCCTAGTTCCTGCCGCTGGTTTC
TGTGCTTAAAAGGGGGACCTCGTGACAGCGCGCGACCAGCCCGCGCGAGCCGCCCTTCCC
TGTAGTCGTGTTTGAGTCGCGGTGTCCTGGTCTGTAGTTCAGGGCAAGTGTCGCGGAGGC
TCTTGGCCCTAGCTGATGAGTGTCCTTTTTCTTCCCAGCTCTCCTGTCAAAACTCGTGTC
TGTTCCTCCAGCCTCCGTCACCCCCCTACTCTCCACTTCCCCTCTGTGTGAACCGTCCCG
AGTCCCCTCCCTTAGTCCCCCCTGCCCGCCCAGTCATGGCAGAGAATGATGTGGACAACG
AGCTCCTGGACTACGAAGAGGATGAGGTGGAGACCGCAGCCGGGGGGGACGGGACTGAGG
CCCCTGCCAAGAAGGACGTCAAGGGCTCCTACGTCTCCATCCACAGCTCTGGTTTCCGGG
ACTTCCTGCTCAAACCAGAGTTGCTTCGCGCCATTGTTGACTGCGGCTTTGAGCATCCAT
CAGAAGGTAAATTTTCTGTTAAAAGAGGTTTTTTGTTTTGGGGCATAGTGTGCTGGTTAG
CATTTTTCAGGGTAGAGGGAAACAGCTATGTTCATTGTTGCTCAGGTAATGTATTTTTAG
AATCCGTCAAGAATAAGAAAACTGTCGGGGCTGGAGGATAGCACAGCCGGTAGGGCGTTT
GCCTTGCACGTGGCCGACCCAGGTTCTAATCCCAGCACTCCATATGGACCCCTGAGCACT
GCCAGGGGTAATTCCTGAGTGAAGAGCCAGGAGTAACCCCTGTGCATCACCGGGTGTGAC
CCCCACACCAAAAAAAAACAATAGCATAATAGTCCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved