Sorex_araneus Locus Mono:821:SNORA29
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:821:SNORA29
Sorex_araneus
Mono:821:SNORA29
GeneScaffold_1338
SNORA29
1001..1140
2140
CCGGGGGAAATCAGCATGCTGGAATTGATAGGGAATGTTATTAAAGCTCTGGTTGGTGG
CACTTGCTGGCACTCTGCTGGCATGATCCCTGAAACTGGCTTCCTGCAGTGAGAGCAGGG
AGCCTCAATAGTACTCATACAAATGCAGACTTACTCCCAGAGTTTCTTACCTTATAACTT
CCTTGAGCTTTCATGGCAACTCCTGGATACTTAGGACCAATGAGTCTGTAAAACTTGCTG
TTCTAGTGCCCTACCCTCCTGGCCTCTTCTATTACTCGGACAGGGATGGGAATCTAAGAC
TAATAGACAGAGATAGATCCTGCTGTGTCTAAGCAAGGAGTTTGTGGTCAAAACAGCTAG
TTATTCCTGCCTTATTTATAATTGTTTGAAACACTTGTTAATACATAGTATTTAAAAAGT
AAAACACTGGTTTATTTTGCCCATTTTCTTTTTCCTAGATCGTGACAACTAACCTGAATC
AAGGAGGTAAGTTTCTGCTCTTTAAAAAATGCTTTTCTCAGGACTGGAGAGATAGTACAA
TTGCTAAGGGACTTGCCCTGTATGTGGCTGACTTGGGTTTGATCCCCAGCACCAGTATGT
TTCTTCAAGCACTGCCAGGAGTGATCCCTGAGCATAGAGCCAGGAGTAATCCCTGAGCAC
AGCAAGATGGAGGGAAAGAAGAAAGCTTTCTGAATTCCCTGTACCATACAGTTCCCCCTT
GCATACTGCCTATAGCCCTCATGACCACTAGCACTGCTGAGAAAGGCCCCCTCTTCCAAA
TAAAAGAAAAAAAAAGGAAATCAAACACACAAAAGAATTACTTCTTTTGTTTCACTATTT
TAGGGATTATTTTTAACTCTAACACTCATAGGTAGGATATTGGTGAGTTTTCAGAAAAAG
AAAAAGTATACAATGAGGGAGTGATTTCATCTCCTGTGGAAAGGTGTGAGGAAGTGCTGT
GGCGGTCCCTCTAACATTGACCCTCTAAAAAAAAGTGCCAGTTTCCCAATTGACTACCAC
ATTTCCTTCTACTTGTTGATTTTAGTGGTTATGCTTATGAGATCTAGTAAAATTGCCATG
ATCTGAAGAGGGAGAATTTCTTTGTGTCCTCCTCCTCTATGAAATGACTCAACAGAAAAA
TTAAAAATGGGAGCACCGAGGTGATGCTGTGCTGTGACCAACACAGGCAGCCAGTTACTC
ACAGGGTTCTATCTTTCTTCTGTTATTTCTACATTGGACATCTCTAGATCTCTAAAAAAG
TAGCCTGCTCAGTAGTAGAGCATCTTTCTCCCAAGTGTGAACCTCTGCACTTTATCCCTT
GCATTGGCCATGGGTGGGGGTCAGGAGAACCACTATCTTCCTTTGAATAGTGGTTATTTA
TTCTTCATCCAGAAGAGAGATGAAGTCCTGCAGATGTCCCATTCCTTTGATTTCTTGTAT
AGCCTTAAGTATCCAGATTCAGTGTTTGCCTGAATCTAGAAGCTTCTAGTTCCATAAAAA
AAGAAAAAAATATTGTTTTGTTTTAATATAAAGATACTGCAATAAATGCATCTGTAAACA
TCATTAGTAACAAAAGGTGATCCTGCTGTGTCTAAGCAAGGAGTTTGTGGTCAAAACAGC
TAGTTATTCCTGAAATAATTAGTTGGATTTATGTGTTTTCTTTTAGAGTTGAAAAATAGA
AAATACAGATTTCAATTATTCCATACATTGGGGTTCCTGTGTATCACAAGGAAAGGAAGA
CATATTGAAATCTGTTCTATTCTAGGACAGGGACATTAATTCAAGAAAACATCATAGAGA
AAGCATGGCTTTTCCACTCACACAGCTACTACAATGCTTTTCCTTACAAGCTGTTGGAAA
ACTTAATGAGATAATCTAGTGGGGTATGCTTGCCTATAGGCCTAGAAAATTTTCTGCAGC
TACTTCTTTTACAAGTGGCAATTTACACAGCAGAAGTTAGATAGATACAGTGTTTTGCTA
TGTATTCTAAATAACTATTTGCAAATAAACACTTTTAATTTTTTTTCAGGCTTGAAGATG
CTTCATTTGGATTGAATTAATTTCAAATTCTTCTACTATTGTTATAAATGCTTTCATGCT
TTACTTCTGGCAGTCAAGAAATTTATGAGTGTTAATACAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved