Sorex_araneus Locus Mono:689:SNORA32
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:689:SNORA32
Sorex_araneus
Mono:689:SNORA32
GeneScaffold_4221
SNORA32
1001..1118
2118
ACCCAGATCCCCCATTTTCCAGTAGCTAGGCAGTCACAACCACAAACTGCCCCTGGCAG
CCGTGTAATCCCATCAATGACCAAGATCCAGAGACACGTATACATAAGCGTATAAAAAAT
TTATCACAGCACATGAATGGCTCCTCCGTTCCTGAGCAACCATGATCCTGGAGGCCCACT
AACTACTTTTGGCAACCAGCGGCTTCTTGCAGAAATGCCTCTAGACTGTGAACTAAGCTA
TGGTCCCATGCCGCTCCGGGAGGGGGAAGGTTTTTCTCTCTCGGTCTTTCCTTTCGCTGG
CGGTGTGGCGACCTCCATCTTGTAGACCCCACTAAATAGAGGTACAAGCTTGCAGTGATG
CAACTTGTGGCAGAAATTTCTCTGAATTTAATTTAAAAATCCAAAACCTTATATGCTCTT
CATTCTCAGCAATGGAAAACATATTATCAAATGATGCCTTTTTGGCAGTTCTGATTGTTG
AGGGGAAATTCCAAATAATCATAGCGAATTTTCTGTTGAAATATTAAATGTAATCAAAGT
AAAGAGAGATTAAAGTGAAAATCATCAGCTACACACACAGGCGGGGGAGAGGGGGTGGGA
TGGGAGGTATACTAGGGTTCTTGGTGGTGGAACATGTGCACTGGTGAAGGGATTGGTGTT
TGATCATTGTATGACTGAGACTTAAATCTGAAAGCTTTGTAACTTTTTCTCATGGTGATT
CAATTAAAATATAAAAATAATTAAATTAAATTTAAAAAATATCAAAATATTTTTGACAAA
AAATATTTATCACAAATTTTATTTTAGTTTTTGATTTTTGGGTGACACCTGACAGTGCTC
AATGCTTATTCCCAGCTCTGTGTTTAGGATTTCCTGGTGGAACTCAGTGGAGTGGACCAT
ATAGGGTGCCAGGGATCAAACTCAGCTGTGTGCAAGGCAAGCACCCTTCTGACTGTACTA
TCTCTCCAGCCTCTATTACACATTTTAAAGATTTATTTTTAAGGTCATTATCAAAGTTTT
TAGAACACTGTTTCTCAATTGCCATGGACATGACCTTAAAGAAAAATTCTCTTTAGAATT
TTAGGAGACAATTAGAATTGTCTTCTGCTACCTAATTTTGGTAAACTGAATTATTTTAAC
GTATGTAAAATAAATCAAATTCAACATGTGCTCAGCCCATAAAGACTTATTTTTTAAGAC
AGGTGAGCTAGTGCAGGGGTTAAGGAGCTTGTCTTGCATGTGGCTAATCCCAGTGTAGTC
CTCTGAGCATCTCAAGTGACCCCTGATCATAGAGCCAGGAGTAGCTCCTGAGCACTGCTG
TGGATGTGGCCCAACCAACATCCCCAAAAGAAAGATGTCTGAAATAGATACCACAGTTAC
CACAGTGAAATTAAGTGACAATATATAGAAATAAGAAGCTCTTGTTTCTAAATGAAGACA
TTTCTTTTTCACTTACTTCCACTGCTGCTGCAACCTGAGGCGTTTTCACCAGGAGAATAC
CCCATGAAGCCTCCATTCCCATTAGGGTTAGAAGGCACTGTTGCAAGAAGACCTAAAAGG
AAAAAAACTCCCATTAAATTATTATCAGGAGACCAGAAAGATAGTTCAGAGAATAAGGCA
TTTGCATTGTACACAGTCAACCTGGGATCTGATGCCATACAGTCTCTCCTGTACCTGGCC
AGGAGTGATCCCTGAGCTCAGAGCCAGGAGTAAACCCTGAACACTGCTGGAGGGGGCTCC
AAAACCAAAATAAAGCAAACAACAACAACAACAAATTGATCAGACACAAATTCAAGGATA
GGAACATAAACTGGCAAAGAAACAAATCAAAGACATTTACATACCTAATCCTCTGTATCG
TGAAAGCTGCTGATAGATCTGTTTCATCCTCTCGATATTCAAACGGCTTGCCTCAGCATG
GTTCACCATAGGCTTAGGATAATTAACTCCTATCAAACATTTGGCTACTTTTTGGATACC
TTCTGGTGCATTCCAGGGATCATATATATATTTCGCAGGGAAACCTCTAAGGACAGGCAA
GTAACGCCTTTTGGGAGAAGAAAAATCATTAATAAAATGAACTATTAATAAATTATAATT
CAAATCAATACCATTTAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved