Sorex_araneus Locus Mono:837:SNORD50
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:837:SNORD50
Sorex_araneus
Mono:837:SNORD50
GeneScaffold_3152
SNORD50
1001..1073
1482
TGCAGCGGATCTGTGATTTGGGCTGAAGCCTATCTGTCTGATTATACAGCCAGAGGATC
GGGAACAGCGGTCTCAATTTGGTTCCTTTTTCTTTAGGTGCAAAAGGAGAATCGCAAAAT
TTGGGGAGAAATACAGGTTGGAAACCACTTGAGTCAAACCCGACGTCTGTACCAGATGTG
TTTTGAAATGGTGTTTTGATTTTGGCAGAGACTTAACTGTTAGCCCGCATAATGGTTCAA
CGAAAAATTGCTTTATTTGATTAACCGGTGAATCTGCGGGGGAATAGCGGATGTCGACCA
CCAGATAATCTTGAGAGTAAGTTGTGTGAATGAAGCCCTTTGAGTACTTGGCTACTTGTC
CCTAAGGTTTTGGTACTTATCCTTGTGACCCAGCTAATGGATTGTGCTCTGATCAATGAT
GAAACCTATCCCGAAACTGATCACCTGAAGAAAAAAACATGTTACGGATTCGGCTTCTGA
GATGAAAGACCACATTCCATAACGATAGCACATACTTATTTGGCCTGGCTTTTTTTAATA
ACTGGGGGGGCAAGTTCTGTTATTTTCATCAACTTTCAAAGGAATTTATACCTCACAATA
TTCCTTTCCTCTGCCAACAGTGAGAGGTCGCTGTCCATCCAAAGTCCATTTTGCTGTGAG
GCTGCTGCTGTGACCCATTTCTGTGAGTTAATTTTTGCTTAATTTCTGGGCAATTAAGAT
AGTTGATCCTTGGTCTCATTTATGATGGTCATGTACCAAACTTGAATTTCTGTGGAAAGA
GCCCTAGAGGAATCTGGCTTCTAAGGGATCACTAAAGAAAATAAATATTTGGCAATTTAG
TAAAAAATGGTAGTGTAGCTTATCTTTTTTTTTTCCCTTTTTCTAGGGTTACAGCCAAAG
GATACACTTCTGGAAAGGGTGATTGGAAAAAGTTTTGTGGACCTGGAAAGAAAGCATTGC
AAGTCAAGGCGGAGTGTGTTGATTTTTGTGTGTGTGTATGTGATGACTGGCACACTAGTG
CTCAATTTCCCCAATCTCCTTGATCACCTCTTTGGAAATAAAAATGCATAATTATAATAA
AAAGTTGAGTGAAAGATAACTGTCTATTAGGTGTGGAATGTTGCCTTTGAGCAGACACAG
TATTCCAGGTGTTTCTAGATTGCTGTGGAGGTTAGAATCTAGTCAGCCTACTAGATGTGA
GAGAATAAGTGATCAGCCTGATAACTAGGTCACAGTGTTCACTCACTATAAATCTGAAAG
TGTGCTTAGGCAGAAAATAGGATGAGAATAGAGGAAACTGAAAAGGAAAGCTGGATACTT
AAACAGAATGGGTAAAGTTAGTGGAAGGACTCAAGTATGTAAGATGCTATGGTGGAAGTT
AACCTTGATTCAGCATTAATCCCCTTAGGTAGTTTCATATACTACTACCAAGTAACATAC
CTGGCTAGTAATATCAACTGCGTTTTATTCCAAAGATTCTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved