Sorex_araneus Locus Mono:753:SNORA27
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:753:SNORA27
Sorex_araneus
Mono:753:SNORA27
GeneScaffold_3469
SNORA27
1001..1122
2122
TCTACTATAATGGTCTGAATCACTCTTCAAAAAAATATCAGGATAGGGGCTGGAGCGAT
AGCACAGCGGGTAGGGTGTTTGCCTTGCACGTGGCTCACCCAGGTTCAATTCCCAGCATC
CCATATGATCCCCTGAGCACCGCCAAGGATTATTCCTGAGTGCAGAGCCAGGAGTTACCC
TTGTGTATCACCAGGTGTGACCCCTCAAAAAAAAATCAGGATAAATAATTTCCCCTAAGA
TACTTCACAGTATGGTTGGAGTAACAGTACGGCGAGGAAGGCACTTGCTTTGCATGAGGC
TGACCAGGGTTCGATCTTTGGCACCCCAGATGGTCTCTTGAGTCTGTCAGGAGTGATCCT
TGAGTGCAAAGTCAGGGGTAAGTCCCGAGCACACTAAGTGTGGCCCCAAATAAACAAAGA
AACAAGAACCAAAATGGTATCTCCTGGCTCTGTTGCTGATGCCCAGAGGAAAAGAAAGAA
CTCCCAGGCTCCCCCCTTCCCTGCTTTCCCCATCACAGGCTGGAGAAAGGCAGTCTCTGC
ACACACCCAGCACAGTACATGTGACCAAAAACCTTATAAACAAGAACCAGAAAGCATGCT
TTCTGGAAGCATAACTAGAGGACTTGAATCGTTAGTCTGTCAAATCTCAAGTTTGGACTC
CCATGAACTGGAGTGAAGATACAAGCTATGAATAGCAGAAAGCACAACTTTAATTTTTAG
GAGATTTGCCACCACTGATTTTAGCAGGAGAACTTCTAGAGTTATGATGTTTTCCAGTTT
CCTTTCAAAATACTCTTAGTTCAGAGGCTCAGCAACTCACCCTTCAAAATATCAGCGGTC
TCCCGCCTAGGAATGAGAACTGATGAGCGAGAACAAGTTCTGACAAAGAAATTGGAGTGG
GGGAAGAGGATTTAAAACCATATAATCATAGGCGAGATAGTTAAAAACCTGGAGATATGA
ATACCCATAGGGGAGAAGAAAGCCCTTTAAAGATTACGTTAATGGCCCCGCTCGCTTAGC
AAACTGAACTTATGTCTTTAGTAGCCATTCATGTGGGGCAAAGGAAGTGCTCTGTCCAAA
CTCAAGAAAACTATGTGTTTAGAACCTGTCATAGGGAGTAACAGGAGCGAAANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCAGGAGTGAGCCCCCAACAGCGCTGG
CTGTGGCCTGCTCATTCCCTCACCCCCAAATCACTTTAAGGTCAGTAGTAAAAAGATCTG
ATTTGATCTTGGATGTGGTACCACCTTAACTGCATAAACTTGAGATCTGACAGACTAACG
ATTCAAGTCCTCTAGTTATGCTTCCTAGAAGTTTTTCTGGTTCTTGGTTTTGGTTCTGGG
TCACATCCGGCAGCACCCAAAGGACGCCATGGAGTGCTGGGGATTAAACCTGCATCAGCC
ACACGCAAGGCAAGCACTTTAGCCCCTGTACTATCTCTCCAACCAGGAAGATTTTTATTT
TTTTTAAAAATGGAAATTATTTAAGGGATAAATAGAGTCTCATTTAACTTCAAATAAAAG
AATTAGTCTCAATATTCTCTTGGCTAAAAGATTATTACCCAGAAACATTTTCATTCCTGG
CCTTTGAGACCAACTGTAAAATTAAAAATGACATGTTTCTGTTTTTTTACATGATGGTGA
TTTCACTTTGTGAATTAACTAAGGAAGAATTCATATGCTCCACAGAACTGACTAAAATTA
GAAACTAAAGCAGGTGGAATGTACTACATGATGTGAAGGATAAGCAGGAGTTTTCGTCTG
GGAAAAAACAAAACAAAACGAAACTACTAGAATCCCACAAGTGAAATACATAGTGAGATC
TCAGGAAGGGCCAGAGACGCTCAGGGTCATTTTAGCCCACGCTGCAGTGTCCTGTGGAGA
GAGAGGCTGAGGCTTCCGTGACCTCTGCCTAAGCCTCTGTGCACCTGACGGTCCAGTCGA
GCAGAATCACTTAAACTGGGGTGGGGGGAGGAAGGCACGGGGACAGCAGGATGGTGTGAG
ATCAGGGACTCAGTCAGGGGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved