Sorex_araneus Locus Mono:435:SNORA48
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:435:SNORA48
Sorex_araneus
Mono:435:SNORA48
scaffold_38413
SNORA48
1001..1132
1376
TCGGCCATTTGAGTGACATCTCTGCCTCCACCCCCAAATTCCTGATTTAAAAAAATGCT
GTCTCTTGTTCCTTAGAGTCGTTCAACTAAAATTTTCAATTTCATTTATTGTATTTTTAG
TTTTATAATTTACATTTGGTTCTATGTGGTATTTACTATTTCCTGGAGATTTTTTACTTC
TTTTTGTTTCAGGATAATTTATAATTGCTTGTTGAATATTTTCTGATACTTTCAAATTCT
TGTCTTGCCTCTGTGCTTGATAGAGAGGAATCTGGTCAGTGGTACCCATCTCCTAGCCAG
GGACAAAGCAATTTCTTTCTTTTTCCAGAGTGGCTTTTGGTCTGTGCCCTTACCTGGTTC
ATGTGCTATGAGTAGTATCACCAGTACCTGCCACCCCAATCTTACTCAGTGGTGAAGAAC
CATCTCAGAACTGTACATCTCAATTTGCCATTTAATTGGCCATAGTAAAAAATTGGTAAA
TGATAGCAACTCATTGGAAAAACCTTCAGAAAGAAAGAAAGAAACATGCTTTGAGGATCA
TTTGTGTGTGTATGTGAAAGTTATTAGTTTTACAACCAGTAATTTTTAATGGAAACAACT
TGACCACAAATCTGTCACAGAATTTTGAGACCCATTAAAAACAAAATTTAATGAGGAAAA
AAAATTCCTTGTCAGATAATTTCCCTATCTGTGAAAACTTAGTGTTAATGACATTTGTTT
GCCTTTCATTCAGGCTGAGATTTTCATTGTTTTTGCAATAAGCAGTTTTATACTGTATCC
TGAATATTGTAAGTACAAAGTCATGTGACTCTGGTTCTTATTTTGGTCTTTATTTCAGTC
TTTTAGCAAGAGGAAAATGAGTTTTTGTTAAGAATGCAATGCTGGCCCAATTTTGGAGGC
TGTGATTCATATATCAGTTAAATTTTCAGGATTTCAGTGGTCTTCTTCTGGTCTGCCCGG
GCCACTTGTGTGCCCCAAGAGACACATCTGGATTCTAGGCAGTGTTCCAGAATGGGGTTT
CATTTTCAAACCTTTTGCTCTGTTATTTTCTAGGTAACGTACATAGACTGCTCAAAGATC
TTCCCAGGATTTTTGGGCTCCTTTCTTTCCTTAGAGAGAGAGGGAAGGGACACTATTTCA
ATTTGCTTGTTTATTTGTTTGTTTGTTTTTGTTTGGGGCCACATACAGATCATGCTCAGG
GAGCACTGGCAGTACTCAGGGGTGATCCCTGAATATCAGGTGTGAGCCCCAAACAAAAAA
AACAAGGTTGTCAGTTTCTGTCTGGTCCTGTAGCTCAGGAACCTGGATATTCCTTGGAAA
CTTTTTCATTTATTGGTATTTCATGGTTTATTCTCTTCAGAGTCCAGACTCAGAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved