Sorex_araneus Locus Mono:728:SNORA26
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:728:SNORA26
Sorex_araneus
Mono:728:SNORA26
GeneScaffold_5577
SNORA26
1001..1117
2117
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTGATTATGCAATTTCTTC
TGCTGTTACCAGAAACCAAGAGGGTGGAAATGATCCAAGGCAAGAAATTACTCGGCAGAG
ACATACAGAGGTGAGCCGTCAATGACCACAGTAAATTACTTTTTCACATTTTGAATCTGG
ATTTCAATATTCTCCTCCTTAACTCGGGTACCATCCTTAAGGACAAATTGCTCCGGAAGG
AACCTTTCACACATGAAAATAAAATTGTGTGTAAACATAAACTGTCAAAAATATAGCAGG
AGTAGCACTTAGGAACATGTGTGAGGAGTTGGCTGAGTGTCCCTTACCTCGTGACACTGA
GTGGCCTTCCAGTCCAGTCTTTTCTGCAAGAATTTTAGGATTTTGACATCCAGATCACAT
CCCACAAGGCAGACATCTTGAGAAAGACTGCTATTGTTTGTTTAAAGAAATTAGGGTCAG
GGCTAGGAAGTGGAGGACACAGTATAACCCCAAGCCCGTGATTTCAAAATAAACTTATAA
TAAAAGAAGACAAGATGTTCTAATGAGGCGCGCAAACCTTCTGAACGGCTCTCCTTTCTC
AAGCCGAGAACAGAGGCCGAGCAAGTCGTCCACAGGACAGGCTGCTCTACGAGTCTAGTG
CCTACTGCCCTGACGACGACGAGAAAGGCACAGCAGTGAGACGTTCATCTTTATTTGTTT
ATTTATTTATTTTTCTTTTTTTGGGTCACACCCGGCAATGCACAGGGGTCACTCCTGGCT
CTGCACTCAGGAATTACCCCTGGCGGTGCTCAGGGGACCATATGGGATGCTGGGAATCGA
ACCCGGGTCGGCCGCGTGCAAGGTAAAAGCCCTACCTGCTGGGCTATTGCTCCAGCCCCC
GAGATGTTCATCTTTAAAAAGGCATCCACACACTCTTTCCTGCGCCCTCTTAAGGCAGCC
TCAGGGCTCCAAGATGCTAACACAGAGGGTAAAGGAAGAATCATAAAACATCCCAGATTG
TAAAAACTTTTCCTTGCATCCTGTTTGGAGTCACAGCCTAATAATAATAATAATAATAAT
AATAATAATAATAATAATAATAATAATAAGTCATCTACAATCCATTTTTAATAGGGTGAA
GCCTGAGATTTCTAGGAAAATGGATACCTTGAATTTCTTCTTTTTCCTCTTTTTTTTGCA
GGGGGCGGGCAGGGAGGGAGGGGAGAATCCACACCCAGTGGTGCCCAGGGCTGATTCCTG
GCTCTGCCCTGGGGGTGACTCCCGGCAGCGTTTCAGAGACTGTCTGCAATGCCAGGATCT
CTGTTGGGGCAGCTGCAGGCAATGTATGCACCTGTCCCCTGTACAATCCATCCAGCCCCA
ATACCGATACCTTCTTCTTTAGCACTTTCGTTTTTGTTTGCAATCAGAGAATAGAAATGG
ACTATTTTTTTTTTTTTTAAATAGGCTCCCAGAGAGTGGACAGGATGAGAAGCAGCAATA
AAGTAAATCACTTCCCCTCCTTATGGTTCACTGCCATTCTTTAGAGTGAAGCTGTCACTT
CTGGTTGTCACAAATGGAGCCACTGAACCCTTAAAAATGTGGCGAATGCTCCCAAGGAAC
AAACGTGTCGGCTTAATTATCCTTAAAAAGATAGATGCTCCACAAAGGTAGAAGCAAACA
GTTCATTCCCACCCTCTCCAATTTTCTGTAAATCTTAATTTTAATATGACATTTATCTCT
GGGTCTCTTGGAGAAGCTTCATAACTGTTTGCTGGCTGTTGGGCAGCTAGACCAGTTTCT
AAAGACCTTCCAGTTATGGTGAAACCTATTTATTTATTTATTTATTTATTGCCACACCTG
GTGTTGCTCAGGGGTTAGTCCTGGCTCCACACTCAGGAACTCTCCTGGTGATGATTGGGG
ACCATATGTCCCAGGGGTTAAACCCAAGTTGGCCAAGTAAGGCAAGAACCCTACCCACTG
TGTTCTTTCTCTGGTTCCCCCCTTTTTTTTTTGGCTTTTTGGGTCACACCCGGCGATGTT
CAGGGGTTGCTCCTGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved