Sorex_araneus Locus Mono:20:SNORA51
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:20:SNORA51
Sorex_araneus
Mono:20:SNORA51
scaffold_255284
SNORA51
1001..1137
2137
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCAACTCCTAATACCATCACCTTGGGATTAGAATTTACGGTTCTGAGTCACAAGA
TGGCAAAACTCAGACTATTGTAGACCCATAAGAACACTGATAATGGTGAAGTCAAATTTC
TTCAAATATTGCGTCTGACATCAAGTATGGTTCATCTCTGGAGGCCAAAATAAATAAAAT
CCCACCAATGATTACGATAGATTTTTAAAAATCTTTTTGTTTGGATATCACATGCAGAAG
GGAAACAAGGATATTTGTAAATTTTCTTAATTATTTTTATTTTGTTTGGAGGACACAGCC
AGTAGTCCGGGCCCAGAAATGAGTAACTCCGATAGCAAATGTGAAATCGACCTTCTCATG
CTGTGGCATTATTGTCCAAAATTAAACAATCTGAACTGACAAAACTTATTAAGAGTCATT
CCCATTTTTTTTTTTATTTTAAGTTGTCACATTCCATTGATGTGTGTCTTATGTTAGTAA
AAGGGAATACTAAGATATAAGGGAATAGCAGTGTGTCCTCAGGGACAAAAGGAAGGACTA
TTTCCTTCAACAATGTAGAAGGAAGTGATGCCAGAATGTCCTGATGTGCTTCTTCTTCCA
AGAAGGTGGTAGGGGGAAGGATGGCAAAAGTCCGTTTTTCAGGCCTCCTGGTGTTTTATC
ACAGACTGTGTTCTTTACACTGACTATACACAAAAAGCATGCACAGTAAACCTGTCACGT
ATATATAACTTAACCCAAGTCCTTTGCTTGGCTTGTATTGTAAATGGGGAAGACATGGGG
GACAGGGGGAAGAGTGCATTTTTCCAGGTGCTGCTTTACATTTTTTTTTAGCCGAAGTTG
ATTATCTCCACAACTCTTAGAATGAGCCTGGGCTTACATGAACTTTAATAGACTGTAAAA
CAGCAGACCACTGGGATCTTCCTTCGCTCTCTATTGGAAACAAACTCAATTCCAAGTTCT
AAATCTTGTTCATTTTTTCAGCACATATAGATGAGTTTTTATATCTACCTATACTTGCAT
CTATGTAGTGTCATATGTCTGCATATATATATATATACTTTTGTATATGTACACATACAT
ATGTATATATATATACACACATATATATTTCTTACCAATCAATGAGTTAATCTTTCATGT
TCAGAGTCAAAATTGAAAAACCCATGCACTCTACAAAAATGATTATTTTGGATTTAAAAG
GGATATCATAGCTGTGATATCAAGTTATTGACCAAGTGTAAAGAAAGGAAGAATTGGCAA
GATTTACCCATAGTAGCAAGACAGGACCAATTCCTCCAAGAGCTCTTATATATTCACTAC
CCATATGTTTGTATACCTAGATGAAAAATATATGTAGGCATCTCACCACTTTATATAAAA
AGGGAAGTTAATATATTTTAAACAATGATTATAAATTAGAAGTTCCCACATTCATGGATT
ATTTCATTTATTTATTTTATCCTCTATTCAAGAGAGTTGGATATAAATCTGTTAACTTCC
TGTTTTCAATGGTTGTGTAACACATGGTAGAGTAAAAGCCCAGAGGAAGGAATAATTTGG
GAGGAACTCAGGGGAAGCTTCATTTCATGGAGGACTCAATAAGGAGTTTAGTTATAAAAG
AAGCTTGGGATGAATCTGGGAAGACTCCATTCTAAGTCAAGGAAAGATGCCAGACTTTCA
AACTGCCTCGGTCTGATCACCAGGAGGCACTGTTTGTGCTTCAGGATGTATGTCATTGTG
AAGATAAGATTCACACAACATATATAAAGATTACAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved