Sorex_araneus Locus Mono:462:SNORA27
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:462:SNORA27
Sorex_araneus
Mono:462:SNORA27
scaffold_223354
SNORA27
1001..1127
1900
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTA
GATCTCCCTCGCTAATGGCCTAGCACTATAAGAACCAATCTCCCGGAAGAGTTATCCTAT
AGGGTTCGGTTGTCGTGATACAGTACTCGATATTATGTTTCATACTCGCCCACAGCTCAG
CAGCTTCCTCTATAGCAATCCTTCCGCTAGAAATGGCACTCTTGATAACTGCGTTGGTTG
AAGGCTGGAGATTAAATTTTTTTTTGGACTAAAAAATGTCATTATGAGGGTGTTTACCAA
AGTAGTAACTTTTCCCTATTAGTTTTCACATCTGGCAGAAGTTACTTATGCTACTTTTCC
TAGGTCCACACATAACAGAATAATTTACTATGAGAGGTTAAAGAGCGGCATGTATCTCCT
TTCTAATAACAAAGTTATAGAAAAAACTCAGGGGCTGTCAAAGAGACAATTGGGTGTCCG
CAACTGGGGAGTAAAATGTGGGGGTTTGGGGGCTACATGAAGTGTTTAAAGAATTGCAAA
GAGTTTTTCTAGTCACAGTTTAAGAATAAGGATCTGTGTTTTTTCTCCAAATTTTCTCCA
TAATTGGTAGTAATGAATGTTCCAGTAATGATGGGTGGCATTGCCCACTTCTCACTATGT
TAATTGGATTTGTGTCTTTACAGATCATTCAAGTGGGGCAAAGGAAATATTATATTAACA
CTCAACCAAATATTGTGTTTATCTTGGATCCTGTCAGAATAAACAACTTGGAAAAAATAT
AAGAAAGAGCAGTATCCATTTTTAGTAAAAGGTAACACTTTGCAGATGGTTTTTCTCTGC
TGTGTTTATTGAATAATGTGTTACATTTCTTGATAGTGTGTCCCACATTGAAATCACAAA
ATAAAACAGTTTTATTAGAGTTTTGTCAAGCAATGTCTTAACTGATCCAAAGTGCTTTTA
GCATTTGAGATGGTATTAATATATAAATGATAAATATATAACTATAAATATATCATTTAT
AGTTATGTACTTTTATATATATAATTATATAAATGATAAAATATTTCTCTATTAGATTCA
TAGATCCTGAAAAATATCCTAACTTTTTCATTGACTAAATGTCTTTCTGAAGCTCTGGAA
AATTCCTAAGAGAGATTTTTAATTCCAAGTTGACTGTGAATTAGATTCATGCTCTTAAAC
GAAATAGATCTATAAAAAGAACTGATAGAAGTAGTGTGAGGAAAGACTCAAAGGGGGCAG
AGAGAGACAGCAGACTGACAGACGGACAGAATAAACAGGCCTGAGGAGTTAAGTATGAAA
GAAGAGTGGTGCAAGGTAGGAGGAAGTGTCAAGTATATAGGACACTGCAGTTTTAATAGA
GAAAGCTATCCTTGTTTAATATAACCAAAATTTTAAACTTTTTTTTCCCAAATAGTCTTT
CAGAAAAGCAAATTCAGAGTCAGGATTTCATATAGAAGCTTCAACCTACAAATTAAAAAT
TATCCCCATTGGGTATAAATAAACGTGTTCTCTTTTTCTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved