Sorex_araneus Locus Mono:434:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:434:SNORA58
Sorex_araneus
Mono:434:SNORA58
scaffold_218010
SNORA58
1001..1128
1569
GTGGCAGAGCACCCATGCTGTCCCTCCCCAGGTCCTCGCGCACCCAGAAGACTGGCTGT
CATGCCCACTATTTGCCTCAGGGTACCATTTTACTGCACCAAAAGCCCTGGTTGAGAGAC
TCTCAATTGAATCCCAATATGTATTATTACCATAAAGCCATGTCTCTGGAACCCAACCAT
TTACAATCTAGAAATTTACATTTACAATCATGGCTTTGTGAGCTCTCATGATACTCAAAA
TGAGAAATGGAAAATAAATTATCTAGCGTCTGCCCCTGGCAGGTAGGCTTGAATGGTGGT
GGGAAATTTTGAGCAAAATACAATGCCCTAAATTAGAGAAAGAGTACTGGGGAAATTGTC
TGCCATAGAGGCAGGGTGAGGACTGGGATGTGGGTGGTGGAAAACGTGCACTTGTGGAGG
GATGGTTGTTCCATCATTGTATGGCTGAATCTCAGACATGAAAGATTTGTAATTCATGGT
GATAAAATTAAAAAAAAAAGTAATGTGGAGTTCATGCCCAATTCAATCAGCTTAATCAAT
GGCTGAACAAATAGCAGCACTCCTACATTATTTCAAAAAAGAAAAAGAAAAAGAAAAGTA
TCCATTTTCTCATGCATTTAGTGGGGTTTCCACTATTGGCTGCAGTTTTTGTCTCTTGAT
CCACATCTTACCATTCACTTCATACAAAGTAGAAATTCATACAAATTCACTTCATACAAA
GTGGCTTCATACAAAGCCACTGTGGTTCCACTTCTTGCTGTCATGTTCAACTTCTGGATT
GTTAATAGCTTTACCTTTCTTGGTCTTTGCTATCCACCTGGTGGTGGTAATGAGTTCCTG
TTTTACTGTGAGCTTTTTTTTTTTTGCCTTTCTGGTTCTTTGTATTTGTATAATCATTTT
TTGTATTTGTATAATTGTATAATTATAATTGTATAATTACAATTCCTCAAAGTAAATACC
CCCAAATAATGTAAGGTTTTCTTTCTTTTCCTTTTATGTGGGGTAGGGTATATCTAGCAA
ACCTTAGGCAGAGCCGCTCCTGGCAATTTCAGACTAGTGGTTTGAGCCACACCTGGCTGT
GCTCAGGGGGATATGTAGTTGTTGGGCTCAAACCCAGGGCCTCATGCATATAGACATGTG
GTCTACTGCTTGAACTATCTTTCTGATGTAGGCATAACATTCTTTTCTTGAAAAGATTCT
GTATGACACAACAAGGATCAAGATTCAGGAAGATTTTCTTTCTATTTATTTATATCTCTT
TTAATCTATCTAATTAACTTCATATACCTAGATTTGTCAGAGATGTCTCTGTGAGAGATT
TCAATATGACATATGATAGGTCATATGCAAAAATGGCTTTCCCAACCACTGTGACAATGA
TAGTTGGAAATTATTTGGAAATAATCACTCTGGACAAAACTAAGTGCTGCAATTAGGTAA
AGAGATATACATGATAACCCTTCAGTACCTGTATTACAAACCATAATGCCAAGGAAAAAG
GGAGAGTGAGATTGAGAGTTAGAGAGAAATAGAGAGAGAGACAGAGAATGAGAGAGAGAA
GTGTGAGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved