Sorex_araneus Locus Mono:408:SNORD113
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:408:SNORD113
Sorex_araneus
Mono:408:SNORD113
scaffold_204426
SNORD113
1001..1074
1224
CCAGTGGTGATTCCTGAGTGCATGAGCCATGAGTGACTCCTGTGCATTGCTGGGTGTGA
CCCTCCCCCCCCAAAAAAAAGCTCTTATTCTTGGGAGCATCTGATTCATGGGAAAATGGA
GGCATCGGTGCACAAAGGAAAGTGCCGAGCCTGGACCAGTGATGAGATTGGAGGGTGTCT
GAATCATCTATTTTGATTGATGCCATCTGTGACTCTGAGGTCCATTGTTCCAGTTAGGCC
CCACTCCTCACATGCAAAGGTCATTGCAGAAGTTCGGACTATTCGAGTTCCTGGATCGTG
GGTGTTGATTGAGTTTCATAAGGGAATAAATACATGGCTAGTTACAGAACTACATACAGG
AACATATGAGGAACATGCTCTCCTAGTTGTGAGAGCACGTAACACAAAGGGGGTGATTAT
ACATTTCCGGAGCACTGAATTTCATTGAAATATACTGCTGAAGTCTGTTGCTTATTTTGT
AATGTTTTTGCATACGGATACAAGTGTGACTCGTCTTTGAGGTTGGTGGATGTCAGCTGT
TTGTTTAATCTCATTTACAGGCAGGAACGTTACATAAATAATTGATTAGTTATTGAATTA
AAGAACGAATGAGCACGGTTCTTGAAATGTGCGTTTTGACAAGTTGTTGTCGATTTGCTC
TGTTCACTGTTTTATTAAAAATTAGGAAAAATCTGGCTTTACAGTCCATGTCGCAGGAGG
GTAGAGCACTTGCCTGGCATGTGGCCGCCCTGGGGCGGATCCCGGCATCCCATACGGTCC
CCCAGACTCCGCCAGGAGTAATTCCTGAGCGCAAAGCCAGAGTAACCCTGAGCGTCACTA
GGTGTCAGGATTAACCCTGAGAGCCCCCCCCCCCATCCATATAGACACTAGCAAGACACA
CTGTGAAGGGTTCTTCATGAGTGACAGAAGCTCATCATGAAATAAGCCTTTCGATCATAT
TCTAGACTAATTCAAGAAAATTGCAAAAGTCTGCATAGTCCCACACTGCGAAATTCCACA
GCGGAAGCTGGGAGACAAGTCGGATCTGCCGCACTGGGATGTAAACTCCCTCACACACCT
CGCAGAGCACTGCCTCACAAGGGAGACCCGGGCCCGGGACAGACCTAGTCCCTGGGGANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved