Sorex_araneus Locus Mono:409:SNORA73
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:409:SNORA73
Sorex_araneus
Mono:409:SNORA73
scaffold_212497
SNORA73
1001..1202
2202
TTCAAACATATGTTGGCCACTTGCATTGAAAACCCTTTGAAAATTCCCTCCTCAATTAT
CTTTTTTCGAAAAATTTACTTGTATTTCTGTTTGATTGTCTTTTTCTTGTGGATTTTTAA
GTGGTTCATATAAAGAAAATTTAAAACAGCCTAGACACCAATCTCTGGTCAATTATATAT
ATTTCAAATATTTCCCTCCCCCCCTTTTAACTTTCTTTTTATGGCGGGGTGTTTCCTACA
CCAGCAGTGCTCAGGGGCTACTCTTAGTACTCTGCTCCAAGTTGGTCCCAGTGGTAATTG
GGGGAGGGAGTGCATGAGGTATTGGGAATCAAACCCAGTTCTTCTGCATACAACGCATTC
GTTCTATGCTTTGAACTGTCTTGGGGCCCTCTTTTTTACTTTCTGTAAGATGATTTATAA
ATAGATATTTTTCACTTTACAGTGTATAGTCAAGTGTATTAAATCTTTTTTCTGAATCAT
ACTTTTTGAATGCTTATTTTAGAACATCTTTCAAATATATGGTCAGAAGATATTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCACTTGAATTACAGCTATGCCAGTG
GCCTCCCTTGTCTCTAGTTTACCTACTGCAGACCTCACCACTCCATAACTCATTGGCAAC
TCCTATAACAAATCTATACGCTCTCTTTATATATTTAAGTTCCAACATGGATATCCTGTG
AGGTCACTCCCTGGACACTGTCCAGGTGGCGCAGAGGAGCACAGGGCTCTATCCCGTGCT
GTATAATCCCTTTCCACACCATTGGAAATCAAGCCAGGCCTTGAGTCTGAGCCTGCATAT
TCCTGCAGCTTCTCAGAGACCTCTGAACAATGACTGGGGAGACAAACAATGCAGGAAACA
GTTTTAAAAAAAAACCCAAATGAATATTTATTGCATTACACGATTATAGTTATTATAAAT
AATTAAATATATCTGGTTATACTTCTTCAAACATGTTTTATAAATTATACATGCAAATAG
TTATAATATTATTTTAAATAACATTAAATATACTTATATGCTTAGAATATAGCTCTTTAA
TAAAATAAATACGTTTTTCCTTCTTTGTCCAACTTCAATTTTATCGTCTAGTATCCTGAT
TGACACAACTTCTGAAAGCGTGTTAAATTTGGTTTTTGTTCTATTTTGTTTGGAGGCCAC
ACAGGACAGGATCAGGAATTCCTACCAGCTTGGTGGTTGGAGGTCATGCCAGATGGTGGT
CAGGGGATTATGTGGTGCTGGGGACTGAACCTAGGCCTCTGCATGCAAAGCATGCTCTCC
AGCCCATTCAACTCTCTCCAGCCCCGAACTTGAATTTTAAGTTCTTAACCCAACTGGAGT
TGAATTTTGTGCATTAATATATGAAGTTATATGAAGGTATCCAATTATTTTTCTAATTTT
ATGTTAATTTCCACTATTTTCCCTACTTTCTGCCATGCTGCCTCTATGATATACCTAAAC
TTTTTTCTTTTTCAGAGGGGGAGCACACCAGTGATGCTGAGGGCTTACTCCTGGCTCTGT
ACTCAGGGATCACTCCTGGTGGGCTCTGGAGACTATCTGGGGTGCTGGGGATCAAACATG
GGCACCTTACCTGTGGTACTATCTCTCCAGCCCCTATACATCTAAGTTTTATGTGCACAT
CAATCTTTGAGCTTTGTAGGTGATTTTGCTGACTTTTTTGTCTCTCCAACTCAGCACCGC
ATGATCTTGATGCTATGCCTTCGTTTTCTGTGGTATGAGATTTATATATATGTAATTAGT
TTTTAAATTTAAACACTGTGGTTTACAAAGTTGTTTATAATACAGTTATTTCAGACATTC
AGTGTTCCAACACCAATCCCTCCTCCAGTGTGACCTGCACCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved