Sorex_araneus Locus Mono:655:SNORA51
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:655:SNORA51
Sorex_araneus
Mono:655:SNORA51
GeneScaffold_2176
SNORA51
1001..1129
2129
GCTTGGCATTTTTACCTTCCCACAATATTCCAACTCTGGGAAGACACATCATTTGTTTT
ATAGCCCCCAAACAAGGATGAACTCAATAAATACACTTCACTCATTTATTATTTCAACAA
ACATTGACTGTAGCTACTCAGAACCCTAGGAAAGGGAGACAGACAGGCCTCCCACACTCT
GGCAATAATGACAATGCACACACCACAAACCCCAGAAGACACAGGCTTGGCTGAAACACA
TCACATAGTGAGATCATGGCACCCTGGCCCGGTGAGAGGAAAGAGCACTGACTGTCAGCA
GCAGAAGGAGCAGGTATGGAGGTAGGAAAGGAGATGATGCTGGGTTGTGCAGAGCCTGGA
GAAGTGAACGTGCTGCTGGCAGATAGGTAGAGGAGGGAAAAGGCGGTGGTCTGGCATCTT
GGAGACACACAGGGGCTAGAGCAACCAATACAGAGCTGAAGATACTTGACTGACCAAAGA
AGGGTGCTTCGTGCAAACAGGAGAGCCTGGGAAAGTTGATTCTCGCTAGCTAGGATATAG
ATGCTGAGCAAAAATGGGGTCAGGATGACACTGGAACTGCACTACCAGCACCCTTAATGC
CATGGTCCATGGTCCGCGACCCAGAAGTGACAGGACAGCCAGTCAAATGCCCAGCCCCAT
GCCCATGTCCAGTCTACCTCACACTCCCAGGATCCTACTTCCAGCTGAACTTCGAAGGTC
AGCTATGCAAAAACTGCTTTTATCCTTCATGTGCCACTGTAGATAGTAGTATACTGCAGG
TATTGCTATCTCCCCTTTAAACTTCCTGTCACCCAGCCCAATGGCTTTTTCTACGTATTT
CCCAAAGAAGAGATTTTAAATCATGCGTGATGGCAATGTTTATGGAATGAAACATTAAAA
GAATGCCAGTTGGAAGGGGATTCTAGAGAACTACAGAAGATGTTATGTTGAGAAAATGAT
GTAAGAAGTCTTAGAAATGATTAAAACAACAATAAGAAACTGGCCACCTGGTGCTGATGA
CAGGATATGTTCTTTATACTATTCTTTATAGAAAGAGGAGGGACAGCAAACTTACTCCAT
ATATACCTCAGCCTCTTGGCTGGTCTGTGTTGTGAATGGAGGTTACACAGGAAAAATAAT
TAATTCTCAGTGATTAGGCAGGCATGGTCCTTAAGGTGCGTGTTTCACTATAATCTGAAG
AAATTACCTATGTGGAATGCTTTTTTTTTTTCAGAATGATAACAATTATCAGTGAAGTAT
GGCTACCTGTGCTTAAAATTTTAAATATAGTAGAAAACCTTAAGTCTTTTATTCTTTAAA
ATTTTGAAAATGTGCTGATCCAATGTATTTTCAAGGAAAATATGGAAAAACATGGAAAAT
AATACTATTCTCTTTATTTGCTCATTTTTACATGTTCCTTACTGACTATATCACATTGTC
TTAGAGTAGCATAAGCAGCACAGAGGAAGGAGAGCCTACAGCTGTCTGCAGACAGCTACA
GAGGCAAAGAGCGGCAGGACCTGGAACACTGATTTTCTCTACTTTTCTTCCCATGCAGAA
ACAGGGAAATGCTGCTGAAAAGTCAGAGAGGCAACACAGCCCTTCTTATCTGTAAGACAG
AGTTTAGTAATTTTTTTTCTAATCTATGGCTACCCACTCTCACACCAGATTTTTATGCAT
AAATAACTTATTAATAATGCCACTTCATCACTTTACCAAATGGCATCTTGATATATTCAA
AGGGGTGTTCGTTACTCAAAAGACCATCTGTCTAAGAGCTCAACATAAGGTTTAAATTAG
AGGTCCCCAAACTTACTTGTCCAACCACCTCCTTTTCAGAAAAAAAAGCATCTCCCTGGA
AATGTGCCTTCTTTAAGTTAATAAAGTGCTCCCCACTGTAGCAGAGGCTACTACATCTCC
CCCCCCCCCGGATGATTCCAGCATCTTCTGGGTGTGGGGGCCAGGGGTGGGTAGGGCAAT
CTGGGCCCTCTTTGGGAAACACTGGCTTTTATAATCACAATCTTGGTTTAAAAGGAAAAA
AAAAGTATGGTCACATTCTATCAAGTCAATATTTACATTTCTCTGTACTCTGCAATGAAA
TTTTTTTTTTTATTCTTGCCATTCCCCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved