Sorex_araneus Locus Mono:279:SNORA61
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:279:SNORA61
Sorex_araneus
Mono:279:SNORA61
scaffold_181761
SNORA61
1001..1134
1505
AAGAGTCAGTTATTTCTTCTTCTTTATTTATTTTTTTGGTTTTTGAGCCATCCCTGGCA
GAACCTAGGAAGACCATACAGGATACCAGGGATCGAATCTGGGTCTGCTGAGTGCAAGGC
AAGTGCCCTACCCACTGACCCAGCTATTTCTTTTTTTTTTTTTCCGCTTTTTGGGTCACA
TCCGGCGATGCACAGGGGTTATTCCTGGCTCTGTACTCAGGAATTACCCCGGCGGTGCTC
AGGGGACCATATGCGATGCTGGGAATCGAAACCGGGTCAGCCACGTGGAAGGCAAACGCC
CTACCCGCTGTGCTATTGCTCCAGCCCCTGACCCAGCTATTTCTATTTCAATCTTAAAAC
TGGATTAGGAAGGCCCTCCAATTCCCGATCCTATTGGATCTGAGCATTGGTCATGGTGGT
CGTGAAAGGAGGAACAGTAACACTGAAGCTGGCCTCACAGGGCTCAGAGTCTGCAACTGC
AGCACATGGGATAGTTTTAAACAAGGTTGGGAAAAAAAACCACCACCAAAAATCGGAGTA
AGAGGTACCATACCAGTAGCCCCGGCAGTGCTGCTGCAGGCCCTTCCCTATGCCCTCAAG
CCACACAGCAAAAGGGCGGGGCCTGAGGAGCACCCTAACTAACTGGAAGCACCCAGAAGC
TGGGTTCTTTGAAAAAAATTATAGTGCCCATAATTTTTACTAGCATTTTAACTTTTACTA
TTTTTACATTTTGTTTGCTTGGGGGCCACATCCTGTGGCACTCAGGGGTTACTCCTGGCT
CTGCACTCAGGAATTACTTCTGGGGGTGCTCGGGGGACCGTATGAGATGTTGGGGACCAA
ACCCAGGATAGTCTCACAAGGCAAATGCTTTGTGCTGTACCATCACTCCAGCCCGCTACA
GTATATTTTTGCATAATATTCTATTAAGGGCTGAGGAAACAGAAACCTGTGCAACGACAA
CCTTATTCTCAAGAAATACAAATAAGATGGCTTCTGTCCTACCCCCAGGCCACCATCAAC
CACGTTGTTGAAAATTTAGAAGTTTGACAATAGTACCATTGGTGCAAGTACTATTTCACT
TAATAGAAAAGAGGCATTTACTTATACCATGGGTTAACAGGGGTGGGGGGCTGCTTGCCT
TGCAGCAACCAACCCTGATTTGCTCACTGGCACTGCATATGGTCTCCTGAATGGGACACA
GTTAAGCCCAGAGCAAAGCAGGGTGTGGCACAGACAGCATCCTTTGTTGATCTCAGGACA
GGGCCAGAGATAGCTCAACCAGCTTCCCAAAATCGTGAAAGAGGCCCAGCTTCCGTATCT
GTACTGCATCCCTTCCTAAGTACCTGGGCATGACCCCCAAGCAGAGAGATGCAAGGAGAC
CCCCAAGCAACAGTGGGCGTGGTGAAAAATAAAAAGTAAAAAGGGGCTTGAGAAACAATC
TCGCCTTGCACATGGCTGACCTAGGTTCCATCCCTGGCATCCCATATGACCCCCAAGCAC
CGCCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved