Sorex_araneus Locus Mono:67:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:67:SNORA58
Sorex_araneus
Mono:67:SNORA58
scaffold_131342
SNORA58
1001..1122
1333
TAAGAGACAAATATTCCAACACTGAGTTCTCTGGGCTGAGAGTAAACAAGGCTTTAAGC
ACTTGGTTGTCTGGGCTCTGAGGGCAAGCAAGATTTTTACCGTAAATCCCAGACTTAGTC
CTCGGGACAATTCAGCTAGCCCTTCCCCAGGGGGTCCTGTCTCTAAAGTTGTAAGAGTTT
GCATGAAAACCATGCATTTATGCTTTCTAGAATGTCCCATTTCAATGCCGGGTAGTTTTG
CCACTCGCCCTGGGTCCATCCCAGTCCCATGGCGGGAACTCCCCTTTGGGGTGTCAGGAA
CTACAGAAACTGAGGCCTGAGTCAAATAGTTATGATCAAGTAATTATGTCCAGGAGCAGA
TATATTTCAGAGTCAATCAACTCCCAAATATTAGGAGCATAGCATTAGTGGTCTTTCTGT
GTTTAACCAAAGAACACTGCTCTATGGTAACATATAAAAAGGCTATAGGGGAAACAGAAA
AGCAAGTACAAATATACAGCACTTCAAATACAAAGCAGTATCAATACAAGTTCAGGATTA
CCAGAAAGTTTTGTTTTACAAGCAATCTAGATTGACATGGGGGACTGTGACAATAAGAGG
TAAAATACAAGGGAAAGGTTACAGATAAACTTTAACTAAGTTAGGGATGCTAGCAAGGGT
AATATAAATTCCTGTAGGAGGAGGGAAAAAGAGAATACACTGATAAAGCCTAAAGCACTT
AGGGTTGATATCCAACAATCTATCATTTCCTTTTCAGCAGATTTGAGTAGTGGTGAGCCT
AGTGTCAAAATATCGAATGTAACCAAAGTAGAGTATGGGGGAAATTGTCTGCCACCTGTT
CCAAGGGTTGGAATGGGGTGGGATGGGGGCTGTGGGAATTTTGGTGGTGGAAAATGGGCA
TTGGTGAAGGGATAGTGTTTGATGATTGTATGACCAAAGCTCAAACATGAAATCTTTGTA
ACTGTATCTCACGGTGAATCAAAAAAAAAGCGGGGGTGGAATAATAATAAAATAATAAAA
TAAAATTAACATTCAGAATAGAATAAAAAATAGTAATGTGGAGTTTATGCCCAATTCAAT
CAGCTTAATCAATGGCTGAATAAATAGCAGTACTCTTACATTATTTTAAAAAATTACATT
ACATTTAGGGCTATGTAGGATAACATTGGTTTTGTCCTTTCAGCCTTGCCAGCAGGGAAC
TTAGGTTTATCAGCTTGCACTCATCACAGTGCTCCCCAGTCACTCCCATTCCTTTGTTTA
TCTGTAAACTCTTCTCTGTGCCCTCCATACGCCAACCAGTTAATCACCTTTCCCCTAATC
AGATTCTGTTAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved