Sorex_araneus Locus Mono:303:SNORA8
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:303:SNORA8
Sorex_araneus
Mono:303:SNORA8
scaffold_186686
SNORA8
1001..1134
2134
ATAATTCATTTTCAATATTTTATGTTATTTAATTATTTTCATTCTTTGAGCCCATCTTT
TTTGGCTACTTTTCATTATTTTACCTTTGCATGTACTATTTAGTGTTACATTTGTTTAAT
TCCTCTACTGAATATTGAACCCTCTTAAAATTTTCTAATCAGTTACTGCTTTATTTAGCC
CTATGATTTCTATTTGGGCTCTTCTCACATTTTGTCTAATCCTTCATCTTTGTTTATCTT
CAGTGGCCATAATTGGAACTGTTGCTTTAAATCTTCTTCAGGAAGTTTGCATAGCATTGT
TGAATTAGGAATCTTTTCATTCTGTTGTTTTAGCCACTGTCATGAGTACCTCCTTCTCCC
AATTGTATCTAGTGTTTCATAAGAGCTTAGGCATGGTTCAGGTCCTTTGCATAAGTAACT
ATGAGTGGTAAACAGAGAACTCATACTCACAGATACTCACAGGCACATAGACTACTGTGG
GACAGGGTTCAAGCAGGTCTGGACACTAAGAAGATGCTCAAGATTGCAGCTATGGTGAAT
GCTAGACTTTCTTGTTTAAACAGACTTGGGCAGTGGTTTGGAAACTTCTACCAGGATGGT
TTTAATAGGAGGTTGGGATATTTCTTGGGTTTAATAGGAGGTTGGGATATTAATTGATGA
CAAAGCTAACAGTCTGGGAGAAGACCGTGAGCACAGTTTGAATGGCCATGGACCAGAAAG
GAAGCATAGCAAGTAATGAATACCCATGCTAACAGGCAATTATTTAAATCTGTAAGTTGT
TTTCTGTCTGTAGGCAGCAGATATAGACTAGCAGAGTTTGGGTCTGCTTCTGCTTATTTG
TTTACTAAATATAAGCACTTTTGGCTCTCAACTGGCCTAGCATTTTTATTTTTTTTTCTT
CCCCCACCTACTCCCAATCAGAAATAGGAGGACCTCACTTACTAGGCTTTCCTTCAGGAT
ATGTTACTATGAAGAATGAGATCGAAAATATAATTCAACAGGATACTACACCAAATCTTC
ACACAGCAGCGCATCCTGCTGGGTGTTGAAGGGCAGTGTGACACAAATCCAGTGTCTGGC
ATCTTTGGTTTCTTGACTTTGTGCTGATAAACCTGGTATTTTTACTGAGACATTTCCACA
CAGATGGGTTTAGGTTTGTCAGAGCATTGATGGAAGAGGAAAAATATATTTTTTAAAATA
AATTTTAAAAAGTAATCCATTAACAATGCTGTCATTGAAACTCTAATGGTTCCAATAACC
ATCAAGATGGTATCTGTTGGTGACTACAGCTCCTATTTTTATTCTAAAGTTTCTTATCTC
CTGTTTCAGTTTAACAAATATAGGACTATAGGATAGGGGATACTTTTTTATGGTGCATCT
CCTGTCCCCAACTTTCCAGTACAAAGTTCTACACCTTAGAGTTCTTCTCCTGAATACCCA
TCACTGCACTTTTCAAATTTCTGTGTTAGTGATAGCATCTCCATTCCTGACTTCTCAGGG
TGCTTTCCTTCTTGCTCTTGATGTCAGAGCTTTCATGAATGGGGTTTCAGACTTGCTTTC
TGTGCTGATTAATTTAGTGTTGTAGATTTGGCACAGTTCAGAAGAAAAAAACACAAGTTC
TCTCCATTTGACCGTATGTCTGCCTTTCTGTCACATATTTTGATGGCACTCAGGAAAGAA
TTCTAATACCCACGGAATGTAAGCATTTCCATTATGAGCATCAGAGATGATATGCAAAGG
AAACTTTTCTTGAGAATTCCTCAGTCAAAGAGAAGAGGAAGAATAAAGAATTCTGCTGTT
GCCCCAGTGACCATATTCCTGATGTTCCTAATGGCAGAGATGTGTCTGCCTTCTTATTAG
TTGATTATTTGGTTAATACTAAATGATTTCTGTTTGAGATGTTCTTGTTTTGTTTTGTTT
CTAGGTCACACCCAGCAATGCACAGGGCTAATTCCCATCTCTGTGCTCAAGATCATGCTT
GTTGGACTTAGGTAACTATATGGGGTGCTTGGTATCAAACCTGGGTTGGCCATATGAAAG
ACAAATATCCTACCTGCTATATTATTACTTCAGGCCCTTTGCAGGAATTATTCTGAATTG
AGTTTCACTCATTCTCATTTATGAATGAGATTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved