Sorex_araneus Locus Mono:442:SNORD113
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:442:SNORD113
Sorex_araneus
Mono:442:SNORD113
scaffold_114688
SNORD113
1001..1068
1324
AAAATAATGTTTAGGCCCGTAGAGGTGGTACGATGGGTAAAGCATTTGCCTTACCCCAT
GGTTGATTCGGGTTGAATCTCAGGCATCCATGTGGCTCATATGGCCCTTGAGCCCTGCCA
GGAGTGATCCCTGAGCACAGAGCCAGGAGTCAGCCCTGAGCACTGCCCGGGTGTGACCCT
TAAAAAAAAAAAGACTTTTTGTGACCGAATACCTCTATCAGTAAGCAATGAGAAATGGAT
GCAGAGATGAAAAATATTGGACCAATGATGATGACTGGTGGCGTATGAGTCTTCTGCGAT
GAATACGTGGGAATCTGAGGTCCAACACAAGGGGACTCTGGTCCATTCTCCTTGTTGGGG
GAGAGTCCATGGACAGGTGTCGCGAATCTTTAAGGCTTTCCCTTTGGGCTGATTATTTAT
ACACTTTCATTCTTATAGTACTATTAGAAAAATGAAAATCTACAAATAAAATGAAGGTCT
TCTATAGAACAAGAAAGGTGGACGCAGTGAAGCGTAGTCCAGTTTCAGAAACGTGTGTCG
AGTCGAGAGGGAGCAATGACATGTATGGAAATCCCGATGTTCAGTTAGAAACAGACGGTC
CACGGCCTGGAGAGAAGGCGCGGAGGGTCAGAGCGTGCGCGTTGCAGCAGACAGCTCAGA
GTCGACCCCAAATGCCACACGGTCCCCTGGACCTGCTCGGCGTCGCCCCCAAACACAGGG
GCCTCATGACAGTCACCAAACTAGCTAAGGATGGGACAGGCGCTCAAGTCAGACAACATC
TAGATCCTGGGTCCCACTCCGAGTTTCTTTATCCGAGACCTCTGGGGGAAATAAAAGAGT
CCCGACATCCAATTAACGACGGTCGGGACGAGCGGCGCCGTGGCAGGTGGGAAGCTCGGG
TCACGAGAAAGAAAGGCTCACCTCTTGCTCTCACTTCTCCGCTCTGCTCTCCTCAGAACT
GACGAGCCTGGGTCCCCCTGCCGCCCCGGCCCCCTGCTCTGGGGTCGCCTCTGTGGAAGG
AGGCAGGAGACAGATGTGAGTAATAATCAAAGACCTTGTCTCGGTGCCGGTCCTTGGTTT
ACGGGTGTTAATAAAAAGCAGGAACTGTGATCGGAGAAGGCCAGCGGTGCCTGCGTGAGA
AATATGGGCTTAATTTGAAACACGCCCTGGGTTCAAGCGCGTGTGAAAGGGGATGCCTTC
CTGCCAGCCCTCGGTGTGACAGGAGCTCCGCAGACAGGGGGCTGGCACCATGGCCTGGAG
TCCGGGGGCTCAGAGTTTTCCTCCGTAAGCAGCTCAGAGACTCGAGGGAGGAGGGGAGGA
GGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved