Sorex_araneus Locus Mono:843:SNORD58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:843:SNORD58
Sorex_araneus
Mono:843:SNORD58
GeneScaffold_6038
SNORD58
1001..1065
2065
TTCTCTACAAAACCAAGATTGCTGGATTTTATTTCAAAGTGATAAAACTGATAAATCAT
AAATATAAAGGATTTTGGGGGGTTTGGGGTTTTTGTTTTTAACTATTATCTTTGGTTTTC
TTATTTGAGAATCTGGACATAGCGTTGGAATAGGAATAGGCTTAGGTCAGTTTGACCTCT
CTGTCTGCCTGGCTCTGCACTCAGGAATTATTCCTGGCAGTGTTCGGGGGACGCAGAGAA
TCAAACTTGGGTCTGCTGCATGCAAGACAGATACATGAACCGCTGTGCTATTGCTCCCCG
TCCGACTTTGAAACTCTTTAACTCACCATTATCCTTGGAGCTGCCATTTAAGAACCATTG
CTTTTAGCACTGATCCTTGGGGTCTGTGTTTTCGTGTTTAGAGTGAATATTATTTGAAGT
CTACAAGGTTTGACTTCCAAAGATGATTGCTGTCTGATTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTGAGCTCTCCTTGCCACATTGAGATGATTCTTACTGAA
AAAGAACAGATTGTTCCTAAACCTGAAGAGGAAGTTGCACAGAAGAAAAAGGTATTTGTC
ACTGGGTTTCATTTGCTTGTGATCTTAGAAAGCATTGTTGGTTGCTGTGATGACTAACTT
AGGACACCTTTGGAATAACCGTGAAAGGAAAACTGTTCTGAGCAACCTCTGACCATTTTA
ACTTTTGTGGATCTAATTGTCTCTTCACTAATAATTAAGTAGATGAAAACTGATTTCTTC
TGGTGGCCCTACTTAAATCTATAGCCATTTAAGAGGCCGCATATTCATATCAATAGGCTT
CTTCCCATCTCTAAAACCTACCTCATTTTCAGGAAATGTTTGCAGATATTTATGCTCCAT
CTGAACAGTGATTCTAGACCCCTCCCTATACTTGAATTTTTTTTCTGTTTTGAATGTGAT
ACTCTTCACTGCACATCCAAGCACAGTGTTCTCTTGATAGTGCTTCATGGTGTATACAAG
TTTCAACACCACAGTAATTTATTTTCCAGTTTTTGTGCTGAAATTTAGTCCTTAGGGAGG
GGGTTTCTCCAAAAGACTTGACTTTACTTTTTCTTTTCCCAGATATCACAGAAGAAACTG
AAGAAGCAAAAACTTATGGCCCGGGAATAAGCTCAGCATAAAATAAAAATCTTAAGTAAA
CCGATTTGAGTGTGGTTGTATTTTTACTAATAATACTACAAAATGAATCAAGTGAGTTTC
CTTATACTTGGGATGGAAACAATTGATGCAGCTTACCTATTAACAGTTGGATTAAAAGTA
TTTTGCATCCCACATGTCCTTCACACACTGCCAGGAGAAAGCCCTGGGTGTGGAGTCGGG
AGTGACCCCCTGAGCATCACTGGGTATGGCCCAAATTTTTAAAAAGACTTAAGTAGTTGA
CCCAAAAAGCAATGCGCACCTTTGGAAGTCTTGGGGGCTTACGTCTCCGTTTGTTTATGT
CCTAGAGAGAATTGCACCTTTTGGTTGTGGTGCTTGGTGACAAGGCAGCCCCCTGGAGAC
CTTGCTAATTGGAGTGGTGTTTGGGTGAAGGTTTGAGTGCTTAAGGGCCGGGCCTGGTTT
TACCAGCCCCCAAGATGCTCGGCGTGGGCTGAAGGAGGGTTTCCCCAACCTACGGGCAGT
CGCAAGTGTCACGGCAACGGGTCTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved