Sorex_araneus Locus Mono:778:SNORD18
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:778:SNORD18
Sorex_araneus
Mono:778:SNORD18
GeneScaffold_5882
SNORD18
1001..1066
2066
GCGAGTCTTAACGCGCGTCCCTGTGCCGCTGGGTAAGACTCGGTCCATTGCTTAAGGTT
TTGCCGGAGAGCCAAGCGCACGTTTAGCTGCTGCGGGCCTCTAGTGCCGGCGGGCAGGAG
TCATTTCATGAGAAATCTCGCGATCCTGGGAAAGATGGTGGGATGGGTGACCGTTTGCTG
TTCGTTCGGCTTCGGATCTACCTACCTGGGTGCCCCCTTAGCTCCCCCCCCACCTCGTCT
TAACCCTGGGCCGTGCTCAGGTATGCAGGCCCTGCGCGCACGGATGCCCGGGCCGCGGGC
AAGTACCCACACCTTCAGCGGTTACCTGGACAGAGGGACAGGCAGGGCGGATGACATGGC
GAGTAACTAGTTAGCGCCCGGCAGGAGGCGGCTGGCCGCTCGGGGCCGAGCCTTTGGAAA
CGGCTGATGGAAGCGCTAGCGAGTCTTGCGTCTCAGAAGCCGTCCCCAGAAGGGGTCTCC
GTAAGGATGGAGGTTGGGGGAGCAGACCCTGGGCCGAGATAAGGAACGTTTGGGGTGATC
CATTAAAGATTACTCCCAGCTTTAGAGTGCTTGATGAAAGTAGTGGTAATTTTTTTTTCC
TAAAAAAACGTGGCAGAGACGAGCAAAGAGGCCTGCGCAAACGGATTTTAGGTGGTAACG
GCATTTATTTTTGCTTTCAGCATTGCCGATCATGGGAGCGTCCTGTAATTGAGTAGATAG
TGATTTTGTTGGGACTTTGAAACTGCCTGGCGTGGCTTCTCAACATGAATGATTGCCTTT
TCTTCCAGGCGTGTGCTCGCCCGCTGATTTCTGTATACTCCGAAAAGGGGGAGTCATCTG
GCAAAAATGTCACTTTGCCTGCGGTGTTCAAGGCTCCCATTCGGCCGGATATCGTTAACT
TTGTTCATACCAACCTGCGCAAGAATAACAGGCAGCCCTATGCCGTCAGTGAGCTGGCAG
GTAAGGGTTTCCCTCTCCTGGAGCGGCCTGGCGGGGAGCAGCGCTGATGATTCCATCCTT
TGGTCCGTGTTTCTGAAGCATGTGATTGTCCAGGATGTTCTGATGCTGAATCCTGCTTGT
ACATAGTAAGTCCCAGACAGGGTGATGGCTAGGTGATTAAACTTGATTTCTCAATTTCAG
GACACCAAACCAATGGGGAGTCTTGGGGAACTGGCAGAGCCGTGGCTCGGATCCGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved