Sorex_araneus Locus Mono:201:SNORD28
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:201:SNORD28
Sorex_araneus
Mono:201:SNORD28
scaffold_250514
SNORD28
1001..1072
2072
TCAAATTTTTTTTCAATACTGACATTTTCTTATTACTCACAATAATTTTTTTAAACAAT
TATACCATCAGTTCATAGGAAAGCACATTCACCATACTTCGCCTAAGAGATTCCCACATG
CCTTTTCATTCTGTTAACCACAGAATTTTTTTTTTGTAGTACTGGGAAGGTTTTAGCTAC
ATCAACTGTGCTCTGGACTTACTCCTGGTTCTGTGCTCAGGGAGAGCTTTTGGTGGTGCT
CAGGGAATCACAGGTGATGGTTGGGAAAGGGTTGTATGCAGTCAAGGCAAGAGCCTTACC
CCTATACTACTGTTTTGGCCCCTGTATATTCCTATCTATCTAAGTCTTTACCACAAACCC
AAACTCTCTTTTCATAAGAACATTAAACCCTTTGCAGTTCTGTGTATCAGCCCAAACCCT
GTTTTGCACCTTTTACTGATGCATTTACTGCATACTTTGGAATTCAAGTCCCTTATTAAC
AAATAATGCCTTGATCATTCCCATATTTCCTACAGAGTTTGCTTAGCTTCTCCCTGGACC
TGTTTAGTTCCAGAGGCCACTGCTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTCTGAAGTCCCATATTATTTCTACCTGGTAGGTTCTAGTCACTTAGACAGTTC
CCAGACTTTTCCCAACTGTTTTTATCTCAAAATCAGCCTGACTTTGAGACTCTGGCTTCA
ACATTCTTTGCTGTCACTGTTGTTGACAATTTAATAGCCACACGATTATCTAATATTTTG
ATTTCTCTGTACTTCCTCTTAAATTCTCTCCCTCTACTACTTTTTCCCCCCATATACCAT
ATTTTCCTACATGACTCAGTTCCTTTTGTACATATCCAGATGTTAATTCTGACTCAGTGT
TGATTTTAGAGTCTATTTTGCTTATAAAAAAATCAAGTCAAGTCAGGTGATTTGAATCGA
TAACGCTGACCCTCTGTGAGGTACAATAATAGCATGTTAGAGTTCTGATGATGGTTAGTT
ACTGAAGAAGCCTTACTCGGCTCCATCATCCTCAATCAACAGTTTGCTTTTATTTCCTGC
AGCTTTTCTGGACGATGCTGCATTTATAATAAGGCCCCATTGGATACTGATCTGCCTGTT
TGCTCAAAGTAGAGCACCTTATCTGGAAAACAAGATGGGTTCCAGGGCAAACTGGAGAGG
CTGTTTCCACCGCACCCTGGTCTGAAATGAGAGGCTTGAAGAATCCAAAACACCGGGAAG
TATTCAAGAATTACATGCCAAATTTCACCGGATTGCTGCCACTTAAAGCAAAATTCAATA
GTTTGCCTAAAGGACAACCTGTTCTGAGCTTAGTGCTGACCCAGGCACACTTTCTGCTCC
GAGGATGGAAACCAGTGCTTAGAGGACGCAACTGGAGGCCATAACAAGTCTGCAATTGCT
TCATTCTTCCTAAATAAAGGCTTTATTAAACTTAAAAAAAAAGTCAAACCAAATTTTAAA
AGATGAAAATCATAGAAAAGAAAGAACAGATTGGTATTGTCAGAGATGGGGTTTGAAGAC
CGAATGAATTAAGATGATCCAAAAATACAAACTATTAATTAAAGATAAATACTTTATGGA
CTTAGAAGGCAGAACACTACCATTAATAAAGCTGTACTCTGTATTTGAAAATGCTAACAT
GGTAATTCTGAATATCCCCAGGGGAAATGTAAGTATCTATGTCGGGTAATGAAATATAAT
CAAGCTTGTATGATGATTTTGCATTATGTATATCTTTCAGATATTATGTTATACACCTTA
AATTTATAGTTATATTAAATACCTTAATAAAACTGAAAAAAGTAAAGGACATAATCAAGT
TCTTTGCACCAGGTCTGAGCAAATTTTCCTTCTTTTCTTCTACAAGCCTTTTTCATATTC
AAATGTATTCCACACTTTCTCCTAGTTAACCTCACAAAACAAGAATTTTGTAAATTAAAT
TAGCTTCTTTAGCATGAAATTAGGAATAATCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved