Sorex_araneus Locus Mono:840:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:840:SNORA58
Sorex_araneus
Mono:840:SNORA58
GeneScaffold_5761
SNORA58
1001..1104
2104
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTAAATAATTAAATAATTA
AATAAATAAATAAAAATTAAAAAATAAATGTTACCATTCAGAATCATCATCATCATCATC
ATCATCATCATCATCCCGTTGATCGTTGAATTTCTCGAGCAGTCTCAGTAATGTCTCAAT
TCGACCTAGCCCTGAGATTTTAGAAGCCTCTCTTTACACATCCTTTCCAATGGTGCCACA
TTGGAGCCTCTTTCAGGGTCAGGGGAATGAGATCCATCATTGTTACTGGTTTTGGCAACA
AATACGCCATGGGGAGTTTGTGAGGCTCTCCCATGTGGGCAGGAAACTCTCGGTAGCTTG
CTATAAACTTCTTGGAGCTTGGTATTAAAGAGTCTCTGGATGTTGGCTGTTGGTGGGATT
ACACGGCGCTGGGGGTAGTCTCTGGGTGTGACCACCTAGCTACTGGAAAATGGGGAATCT
GGGCAGAAGAGGCCCAGTCCCGATCTGAGCAAGCTTGGAGGTCTCAGCCCCGGGTTCCAC
ACACCTGGGTTCCTCTGCCAGTTCCTTCATGCATGAGGCTTGTCCGAACTTGTGGAGAGG
GGCTTTGAGCATGGCTGTGGCTAGGCTTCGGAAGGACTGCCAGGGATTGCCCCCGGCGCC
ATTTAATCCCACCAACAGCCAACATCCAGAGACTATAACACCAAGCTCCTGGAAGAAAGC
GACGCAGAGAGTCTCTTGCCCCTGTGCCTGGCTGTCTTCCCTGAAGCCTCTCGGCGGGGG
TGGGCCTCAACTTCCCTCCCCGCTCCGAGCAGAGTTCCTGTGGCCGAAGACCATTCAGAA
CAGAATTTAAAAATGTAATGTGGAGTTCATGCCCAATTCAATCAGCTTAATCAATGGCTG
AATAAATAGCAGTACTCCTACATTATTAAAATAAAAATTTGCAAACACCATTTGCACACA
TCCCATAATCGTAAAACATCTATAAAAACAGTAAAAGGGAGGATTAAAATTTTTAATAAA
TAGAACACTTAAATTATCTAGGAGCTTGAACCAAAAGTCACAAATGATTAACTGGCCTTC
CTCATTCTGCGGGTGTGTGGAAGTGGACACATATGAGCCTGGACACATAAACTTACCCTG
CTGAGACTGTCTGGAGGCATGGACATTAGTGTTTCCTTCCACACTTTGGAGTAAAATTGT
GCTGATTCTAGGCCACAACAGAATTGCAATCACAATGGGATACAATAGGCAATAAAAGAA
AAGAAGGGGAACTAATCATCTTTGAGAGCATTATGAAAGGCTTCATTGAGGAAATATTTT
GAGCTGAGTCTTGAAGGATATATAGGGATTCATCATGCTAATAGTCCTGCCAGAGGAACT
AAACTAACACACACAAAGATGTAGAAGAATGAAGATATCCTGAACTGTTCAGGAAACATG
CAACAAATTTGGTATAGCCAGTACACAGGGGCACCCTAATGGGAAGAAATAAGAGGTGAG
TCTGAAAAGTTAGGTGTAGGGGATAACAGAAAAAGATGTTATCCCAAAGGGAATGAGTGG
ATATTCAAGGATATTAAGCTAGGGAGTATCTGATTTATAAGAGAAAGATTTTATAGAGTG
AAAGGCCCTAAAGCAGGCAGAAAAAATGTATAAAAATATTCACACACACCTCAGAAACAT
TGCAGATTTGGTACCAGACCACTGTAATAAAATGAATGTCTCAATAAAGTGAGTCACATG
ATTTTTTTGTTTCCCAGCCGATATAATAAAAGTTCTGCTTATAATATACTTTAATCTCTT
AAGTGTGCAATAGCATTATACCAAAAAAATTCCATGTACCTAAATTTACCCTCTCAGAAA
GCCTGGCAAGCTACCAAGAATATCTCGCCCCCATGGCAGGGCCTGGCAAGCTACCTGTGG
TGTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved