Sorex_araneus Locus Mono:80:SNORA3
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:80:SNORA3
Sorex_araneus
Mono:80:SNORA3
scaffold_134575
SNORA3
1001..1122
2122
AAGTGTGGCCCCAAAGGAAAGACAAAGACCCAACAGACCAAAAAGACTCACAGACCTAG
CAAATGAAAAAATTTACAGGCTGAAGGGGAATGGTTTGACTCAGCACACACATGCAATAC
ACATTCCAGTAAAAAAACACTATCCGGGTACATTTGCACTCAGATCGGTGAAGTGACACG
AAGCTATATAGACAAACAACAGTTAAGGCAGTTCACGGCCATTCCATCAGCCTTGCAAGT
AGCCCTAGATGGTCTTCTTTAAAAGGCAAAGAGGGGCTGGAGGAATAGCACAGCGGGTAG
GGCGTTTGCCTTGCATGCGGCTGACCTGGGTTCGAATCCTAGCATTCCATATGGTCCCTG
AGTATCGCCAGGGGTGATTCCTAAGTGCAGAGCCAGGAGTAACCCCTGTGCATCGCTGGG
TGTGAACCAAAAAGCAAAATAAATAAATAAAAATTTTCAGCAGGAGTTTTTGGTGAGTGT
GTAGTAAACCCAGCTCCACTTCGCCGGTGTGGCTGGGCGGCTGTCCCTGGCCCCCAGCTG
TGCTCCAGTGAGTAACCTCATCAAAGGGAGCACAGATCTGAGCAGCTCCGAGGCGCCGGG
CCGGCCTGTGGCTGCAGGTTTAATGACGGCTCCGGGGCTTGGCTGAGGCTGGCATCAATC
GCCTGGCGCGGGCACCCCACTCCACAGTGGCGTCGCGGGGAGGATCAGAAGCTCTGAAGT
CACCCGCTCTGGGTCTGGACTCTGCGAATTGCCGTGCACAAGCCCCGGCACCTCCCACGG
TGAACGAGGCCTGTGTTCTCTCGTGCACGGTGGGGCTGTGAGCAGAGCACGGTGGGGGGC
GGGGGGAGTGACGGGCATTGTGTCTCCTCCCACCATCGGAACCACCGGCTTCGAGACCAC
AGACCTGGCCCTTGGCGGCGTGTGCAGGGTGCCAAGGGTTCTGTGGCTCAGCCCAGTCAG
AACAAGCAAACGCTGAAAATAAGGAGGACAGTTTCAGCTCGAGAGAGAGTCACACTTAGT
ATCCGGTTGCCCTGGGGTGCTAGAGTCCTCAGAGAGTCACTGCTGACCTTATTCACCAGC
TGTGGCCCTCATGGCATAGCCAGTCACCAGGTTAGTGACATGTGCCAGATTGACCTAGAG
TTCCTTGAGCTGGTGAGTGAGGAGACGGCATAGATTTAAGAACTCGTCGAATTCTCTGAA
GTGCTGTCAGCCATGCAGGTTACTTTGGGAAAGTGGCTGTGAGACATTATCACTTAAGCA
CTGTAGTACTGTAGCACTGTCATCCTGTTGCTCATCGATTTGCTCGAGCGGGCACCAGTA
ACGTCTCCATTGTGAGACTTGTTACTGTTTTTGGCATATCGAACACACCACGGGGAGCTT
GCCAGCTTCTGGCATGTGAGCAGGATACTCTCAGTAGCTTGCTGGACTCTCTGAGAGGGA
CAGAGGAATCGAACCCGGGAGGCCACGTGCAAGGCAAACGCCCTACCCGCTGTGCTATTA
CTCCAGCCCTGCTATACTACTTTTCTAAAGTAAATAAATAAATAAGGAAGACAGTTTCAG
GACTGAGCTTTACGTGGGGACTGCTTCCTTTTTTTTTCTGTCCCCCAGTGCTGGGGGACA
GAACCTCCGTCTCCTGCATGCAGAACCTGTGCCCAGTGCCCTGCGCAGGTCTCCTGGGCC
CAGGAGCTGCTCAGAGCAGGACAAAGGGCTCTATTCCTGGCTCTCCGCTCAGGAGCAGCC
CCTCGCCGTGCCGGGAAGGGGCACACGCAGGGTCTGGAGTCCAGCTGGGGGTGAAGCACA
TGCAATGCTTGCGCCTGGGCGCTGAGAAGTCACCACGCACCCTTTGGCCACGGCGAGCCA
GGGGAGAGTCCCCCGCCCCACAATCCCACACGACANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved