Sorex_araneus Locus Mono:545:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:545:SNORA58
Sorex_araneus
Mono:545:SNORA58
scaffold_233100
SNORA58
1001..1108
2108
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNACGCGACACATCATAAAACACTCCCTATCCATTTTCCATAATTACCACA
CCATATTTGATGGGGTTCAGATGGTAGGTAACAAATCGTAGAGGGAAATATATACATGTG
CATATATAACACATATTTTCAGATATATATACCAAAGCTCACATCACCCAAACTTAACAA
CATGTTAGTGATAGCCTATAAGATGTCTTAATGGTTCCTGCCAAAATAGAACAGTCTTCA
CACTGTTTCCTATATGAATACTTTTTTGTTTATGAATACTTTTTTGTTTAGCAGTTACTT
ATTTGTTTAGCAGTTCTACATAACAAACAATACAAAACATACTATTTTAGTTGTGTTTTG
GGACAGGGATTGGGGCTTGAGATGGAAACATCCCAAATTTGGTGGTGGAAAGGTGTAATG
GTGGTGGGATTGGTGTTTGAATATTGAATGTAATCAAACATTGTGAAATAACTTGTAAAA
TTAAAAAAATTTTAAAAAGTAATGTGGAGTTCATGCTCAATTCAATCAGCTTAATCAATG
GCTGAATAAATAGCAGTGCTCCTACATTTTAAAAAAAAGACCAACAAGGGCCAGAGTGAT
AAGTAAGATGGGCAGGGTGCTTCCTTGCACAAGGCCAAACTGGATTTGATCCCAGGATCT
CTTATGGTTCCCTAAGCACTACCAGGAATGAGCCCTGAGTGCAGAGGCAGGAGGAGTGAG
CCCTGAGAAGTTCCAGGTGTGGGGGGAAAACATCCTTAAGAACAGACACATAATAAATGT
TAAATCTATAGACCATTTCTCCTTAAGGACCTTGTCCTTGTTTAGGATAACAGTATGAAA
GCTAACAGTAGGCTTTAGAATGTCACAGGCACAGAAATGAAACTGGTAGGTAGGTCAGGT
TTCATGCTAGAGACAAAATCGTGTGGTGACCATTTCTTTATGCTATTACTGCTGATATAT
TTTGCTACCCCTGTCATTTATTAGGAATCAGTGACAGAGACCCTTTTCTGTCACTGACTG
GGTGGAGTCAGGTTTAGCCACCCACTATTCTGGGTTGTATTAACTAGGCAAATCATGGAA
CAGAAGTCAACAAACCCCTTTCCCAAACCTTAACCATTTCTCTTCTTTCCCAGAATTATA
CTTCATTTGTGCTTGTAATTATGGAAGAATCAAACTTGGGATGAGAAACTGAAATAATTG
TTCATACAAAAGCACTTCTAAGTTCTGTTCCTAAAAGTGTGTTAGTAGAAAAAACATTAA
CTCTTAGTCCTTGATTAAAAAGAAATCTTAAACCTTTCCAAATCTGAAAACTCTCTACCA
TGAACTCATGATAGAACAATAGACCAGAAATATGGAGTTTTTTCTAGACAAAAGAGTAGT
TACAGCGTTCATAGCTTGTGGATTCACTTGTGCAGACCAGTCTTCCAGAATAGAAAACAC
AAGGTTATTTGGACCTTATGTGTCAAGGTACTGCTTAATTTGAACTTCTTAAATAGCTGA
AAGTTCAAAATTTGAATCTACAAACCCTAGAAGTAATGTAGTAATGTATTTGATTTACTA
TCTAAGATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved