Sorex_araneus Locus Mono:626:SNORD36
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:626:SNORD36
Sorex_araneus
Mono:626:SNORD36
scaffold_60412
SNORD36
1001..1067
1221
AATGGGGGTGCCCTACTGCATCATCAAGGGCAAGGCCCGCCTGGGCCGCCTGGTCCACA
GGAAGACCTGCACCGCCGTGGCTTTCACACAGGTCAACTCGTAAGTGCTGGGGCAACCCC
AAGCTCCCAAAGGGGACACTCGAGTACCCAAACCTTTGCCCGTGATGGTTAAGAATTTCT
TCACCTGAATCGTCTATGTGGTCAGAGTATGGCTGAGGCAAAATGTGCTACCAGTGAAAT
TTATTGGTTGTGGCAGGGAGGGGTGTCCCCACCCCACCCCAGTCACTGTCCCCACCCTTT
CCATTAGGGAAGACAAAGGCGCTCTGGCTAAGCTGGTGGAAGCCATCAGGACCAACTACA
ACGACAGATACGACGAGGTAAGAGCTCCTACCCTGGCTGGGTTCAGCCTGGTATTGCTCC
CACCCCTCCCCCAGCACCTAGCTGACTCCTGCCCCCATCTTTACAGATTCGGCGGCACTG
GGGTGGCAACATTTTGGGTCCAAAGTCTGTGGCTCGCATCGCCAAACTGGAAAAGGCCAA
GGCTAAAGAACTTGCCACCAAGTTGGGCTGAGCTGTGGTCTCCGCGGTCCAGGCGCCAGT
CTGTACATAGACATAATAAAAGGTTTCTTCAGTTGCTGTCTGTTGCTTTGGTTTGGAGTC
AGCAGCAGTCTCAAGTCTGACTTTCGGGGTGGGTCCCTGCCACAAACGCTGAGATCTGCT
CCGGACAGGGCAGGCCACAGCAGTAGTCTGCATCACACACCAGGGACCCGGCGTAGGAAC
TTCTGGTACCACAGGTATGATGTGGCCGCACAAAGGCCATACCTTGGATTGGAAGGAGGT
GTCAGGTGGGCGGGGGGAGGAGTGTAGGGTGGGGTGGAGGCAGGCTGGTGGGGGGCTCAC
CATGTGAGGATGTACTGCAGATGCTCATTCCTCAGCGTCACTCTAGTCTGCCCCCAATGG
GGCTCCGGCACTGTGCTCCCTATGAGGGGAGGATAAGGGTTCAGGCCCACCCTGAGGCTG
GGCCAGGGTGGGTGTGTGCTCCCACTCACGGAAGTCAGCATCAATGAAGATGGGCTCTGT
GCCCACGCGCTGCGCCATGGCTGGAACGTCCCGGTAGTGCCACTGGTTTCTTTCTGGGAG
GTTCTCCGGAACAAAAGGCTTCCTCACTTCAGTCAGCCGCACTGCCCCACCAGGTCCAGC
TCCCCTTCGATCTGTGAGGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved