Sorex_araneus Locus Mono:61:SNORA27
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:61:SNORA27
Sorex_araneus
Mono:61:SNORA27
scaffold_128684
SNORA27
1001..1126
2126
GAACATGAAACACACACACATACACACATACACACAACCCCTTTTTTGGTATATTTCTA
TAAGATTGGGACTTTGGCTAAAATAGTAGTGCATATATATGCAAAATAATAGTATACAAT
CAACTCAGTTGTCCAAGGATGGAGGATGTAAATACTATGGTTAGCTAATGCAGCCTTAGT
TAAACAGATAGATTAATAAAGGTAAAAAGAAAGGAGAAAAATCTGAGGATTAAGCTCTTA
CTATTGTTGGGCTGGAGTGATAGCACAGCGGGTAGGGCATTTGCCTTGCATGTGACCGAC
CCGGGTTCGATGTTCGATTTCCAGCATCCCATTTGGTCCCCTGAGCACTGCCAGGAGTAA
TTCCTGAGTGCAAAGCCTGGAGTAACCCCAAGCATCACCAGGTGTGACCCAAAAAGCAAA
AGAAAAAAAAACTTACTATTGTTGATAATAAAAAGATTTTACTATTGTTGATAATAGACA
GATTCTTGTATCTACTGTCTGAGAGATCCCTTAGATAGGATCTATCTAAAATTTAAGTAT
GTTATAAATACTCTTATTAATTAGACATATTGGTCATAAAATTTCCTCCTTCTTAAAGAG
AAAAATCTTCATAGTTAACTCAATTCATGTAAATAAAAGCATTTAAGTAGCTATGGACCA
ATTTCTGCTACTTTTTTTTTTAGGTAGGCTTGCTCAGGGCCTCCTAGCTCTGAACTCCAT
GATCACTCCTGGTGGTGTTCAGAGAACTATATGGGATGGTGGCATTTAAAACCAGTTGGT
TATGTAAAAGGCATATTCCTTACCTGCAGTACACTCTCTCTACAGCTCAAACTATGAACC
CTATCTGCTCAAAACCCCATCCTTCTATACTATCTCATTTAACAGAAACAAATTGAGGTG
ATATATAATAGTGCCTGACAGAAACAAAATGCTAATTTTGCATTTAATAGGAAATGAATT
GTGTTTATAGTCAACTAGTAGTTTAAGAAAAGAACCATTTATACTCCCTTCGCATTTTGC
CTATTTGAGTTATGTCTTTATTGGTTACTCAAGTGGAGCAGGGGAAATATCCTTTTATAA
TTTAAGCAAACAAGTGTTTGTCTTATATCTTTTCAGAGGAAACAATATGGAAGATTTTAA
AATATTTTAATGCTTCTGGTTGTTTTTATTTTGAGCATGATTGAACATTATCTAAATCAT
ATAAATCACTTTTGAAATACTGTTATTTTCTTTCTGAACAACAAATTTATATTAGAAATG
TAACTCTTAGCTCTGATGAAAATGCATATTTTGGTACACCTGAAAATATAATACAGACAA
AATGTTAAATGCCAATTTAATCAAGCTCTTCAATGTTTAACAATTTTCCCATAGACAATG
AATAAAAATTGTTAACTGCAGATGTTGGTCCCCTCATATTTCAAATCTGCTATCAGCAGG
ATTGATTTGAGTACAATATAAACACAGGGATTATGAAATGATAGTTGTTGACATCTATGT
TTATATCTGTGTATTTTCAGATAAACATTAAGAAGGATCTATGAAATAGCAGTCTTGTCA
GGACAGAGGTTATAGATCATTTTTCTTGTTTTTTTTGTTTTATTTAATTTTCTAAAATAT
ATATGCATTTATAAATAAAAATCTGCACATTTTACTAAAAACTATTTATAATGAAGGATT
TCAGAAAATTGACTATTCTAATCAGATAAAGATCATGTATTCTAGCATTTTGAAAAATGG
CTGTATGCATATATTCCTAACATTAACTTTTATTTCAGTGATAACACTAAAGATGAGTTA
TTTTTTAAAAACGCATGTCCTCTATTCATTTTATTTTTGGCTTTTGGGCCATACGAGGCA
GTGCTCAGGGCTTGCTCCTTGTTTTGTGCTCTGGTTTCACTCCTTGGATGATTCTGGGTA
CCATGTGTCATGATGGGAGCTAAACACAGATCTGCCAAGTGCAAGAGAAGCACCTTATCT
CCTGTGCTATCTCTTTAGCCTCTATTTTTAGTTTTTGAATTTTGGGTTACACCCACTGGT
CTCAGAGCTCTGTGGTCAAGGATCACTCTTGATGGTGTTCAGGAGACTATTGTGTCAGGG
ATAAAACCCAATTTGGCCATAAGCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved