Sorex_araneus Locus Mono:400:SNORA9
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:400:SNORA9
Sorex_araneus
Mono:400:SNORA9
scaffold_180957
SNORA9
1001..1119
1223
ATGTTCACTACTGGGTGCCGCTCCCAAGCCAAAGAATAATAAAGTGAGAATTATCCAGG
AATTATTAAAATTGCAGTAGGAATTCATAAAAATTGGTTTCTTTTGTGCAAGCCTCCAGC
ATGCTTGGGTCTTGGGTGAGCCGGTGCTTTCGAGAACAAGATGAAACCATCTGAGGCCTT
ACCCTCCTCCATTCAGAGCCAGGTTATGGAAATTTCAGACAATTGGAAAAAAAAAGTGGG
TTTCTTTTCAGAATGCCAAATTGACAAAACAAAAATCAATGGAATTTTAAATGAGAATGC
TGGAATGCTGAACATGAGAGCGGCTGGGTCACTGACTCAGTGAATCATTAGTTTTCATGC
GCTTGGGTTGGATGAGGACAGCCGTTGCTTTTCTGCAGCTTGTGTTATGGCTACCATCGC
AATTAAGAAATGGAAAATGTGTTCAAGAGCTCCAACAGAGTCTGGGCTCATCGGCATCAG
ATCCAAGTAAGGAGAGCAAGACCCAGATGCAGCTGTCAGAAAACAGGAAAGAAAGAGCGG
CAAAAATAAAAAAGGACGCGCGGGAGTAGTACAGCTCAGCCTGGGGAATACCCAGCCTGG
GGAAGGTCGCAGCCAGAAACCCGGCCAGGGGCCAAAGGCCACTGGGTTAGTTGGCTTCAC
AGGGGCGCCAGGAGCTTTTGAGAGCCTCCTACACTGTGGGCAAAGGAAAGGAAGCTTTAG
GAGTGAAACTGTTCTCTCAAGTGAGACCTGATACGGAGGAAAAGAGACCATAATGTGGGA
CTCAGCCGTTTTTTTCTATTAAGTGCTTGTGTCCCGGGAAAGGAAACAATGAAGACCAGG
AACTGGAGTCTGCCCTGTTATGGTTCCCAGTAGACCTAACACCTTGACCTCCAACTGGCA
CGCAGGCTTCCCTGCTTCTTAAATGCCTGTTAATATAACCACAGAGGATGCGATTTTTTT
TTCCTGTCTTGTTTAGGGAATTGCTTGTGGAGTTGTCCTTGTTGATGCTTACCACGAGAC
TTTTTGATTCTCAGGTTCTGTAGTATTTTCTTGCATGAAAAGGCCACCATTCTGGGCTAA
TACTAAGAATACTGCTGTGAGCATTCTCTCTCTCTTTTTTTTTTTTTTGGTGGGGGGAGG
GTTGGGCCATGCCTGGTGGTGCTCAGGGCTTAGGACTGGATCTGCACTCAAGAATTGCTC
CTGCCGGTACTCAGGTGGACTATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved