Sorex_araneus Locus Mono:489:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:489:SNORA58
Sorex_araneus
Mono:489:SNORA58
scaffold_259206
SNORA58
1001..1107
2107
AGTTGTGGTCTTCATTGCCTAAGTTCCATGTTTCAAACTTAAGCTAAAAATTATATCTT
CACAGTGTATTTTTACATTTTGTTTTATTTTGGTCATTTAAGAAAAAAATAATATCTGTT
CAGTATCACTTGTATCACTTACCATCCTGTTGTTTGTTGATTTGTTCAAGCGGGTGCCAA
TAATTTGTCCCTATCTTGTGCTAGTGTAGCCCAATGGTGTCTGCTCACTCCAGGAACACA
AAGAGCCTCAAACTGGTCTTGAAGAAGAAGTCTGACCATCTGTTCAGTAGTGAAGATATA
AAAAAACACAGAGAAACAAATGGAAAATAATTGAAATTCTACTCTTCAGAGATGACCAGC
ACATATTCCCCAAGGGCAAGCACTTTGGGAATCTGTCTCTTTTTGGCCATTCATCTGTAG
CCCAGGTATGTAATATATGCTATGAAAATACTGCTATGCATCTACTCCTGATGTAATCCT
GGCGACCAAGAGCTTCCACAAGCAAGGCCCAGGTATGCGGGCTCCAGGACTAAATCTCCC
TGCCACATGGTGGCAGAGGTTCTGGGCTGTCCTTCCTGGGCTCCCCGCTCACTTGTCGGC
CTGGCCGTCATACCCACAATGTGCCTCTGGGCACCATCTTAGAGCACCAACATCCCTGGT
CCAGAGATGCCCAATTGAATCCCAAAAAGGATTAGTGCCCTACAAAAGTGTCTCTGGGAC
CCAACAATCTACAATGTAGGATTCCAGAAGCGTATGGCCATGGCATCCAAGATATTCAAA
ATGAGCAATGGACAATAAATAATCTAACACCTGCCCCTGGCTTGAATGGTGGTGGGAAAA
TTCGAGCAAAACATAATGCCCCAAAGTATTGGGGAAATTGCCTACCATGGAGGCAGGGTG
AGGACTGGGATGGGGAGGGGGTATACCACTGGTGGTGGAAAGTGTGCACTGCTGGAGGGA
TGGGTGTTAGATCATTATACGGCTGAATCTCAAACATGAAAGCTTTGTACTGTATCTCAT
GGTGATTTAAAAAAAAAGTAATGTGGAGTTCATGCGCAATTCAATCAGCTTAATCAATGG
CTGAATAAATAGCAGTACTCCTACATTTTAAAAAAAGAAGAGGAAAATACTGCTATGTGG
AGCTATTGCCTGCCACCTACATTTTCTCATCTACATTTATATAGATGGAATCATGTTCTA
CCTACTGTTTTCCAAGCTATTTTGTAGAGGTAGCAATAAGTCATTTACATTCTCCCAAAT
TAATGCCTGCTTGCTGTGCTATTTCAACAGGAGAATATTATTCATTTATAAAAGGGGGCT
GCAATTTAGCTTGTTCCTGAATGTTTAGTATTTAGGTGGTTTAAAAAAATATTGTATAAC
TCTTTCAAGCAACTTCGCACACATACATACAGTTGTCTACCCAAGTCATACACACGCTTT
TTAATGGTTTTGATTTATACTGCCTCTTAAAATATGTACACAAACCTAATCCAATGAATC
AAAATAGTGAGTCTATTCCATGAAGTAAGAGATTCTATTCATTTATTTACTTTGCCACCA
CCATGTTCAAGCCTAGAGGAATGGCCAGAGAGAAGCAGACTCTATATAAATATTTGTTGA
AATTGTTTCCTCAGATTCTCATCGATACCTTTTATTATTAGTTCATAGGGTTTTCTTTAT
CAGTTTTTTTTATCTGACTGGTAACCCCCAATGATTTGTTAAATACTAAAAAATAATTTT
GAATCTAAGCTTATCAGAAATGCCCTCTGTTGTAGAAATGAAACTGGGATCTCTGGATTC
TGAAATATGCCCAAGCTCAATCTCTTCCCGGAATCCATGCCCTGCCTTAAAGGAGGTTTC
TGCAGGTGAAAGGAGGCAATAGGACTCCGGGGCGCCTCTCATGGCCGGGGGCATTTCTCC
ACTGAGGATCCCTCTTTGATATTTTATACAAAGTTAGCCTATTGTTCTGTAAGGAATGCA
TTTCTTATGTTCTATAAGGATTCAGAGTCTAGGCTTCCATCAGACAACCACAGGGAAGAA
GATAAACAACAGCATTTGGCATCTGGGTGGTGACTTTACCAGACTGGAAAGAAGCCTGAA
GAATGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved