Sorex_araneus Locus Poly:5:SNORD113
snOPY snoRNA Orthological Gene Database
Sorex_araneus Poly:5:SNORD113
Sorex_araneus
Poly:5:SNORD113
scaffold_193936
SNORD113, SNORD113
1001..1075, 4948..5022
6022
CCCCTGGTATAGTAATTTACATTTGAAGAGGCATGATACTTTCCTTCTAAAATAGTCAC
AGTTGTTGTAAATCCATGGTATTTCAATAAAGAACAGTTGGAATGTAAGGTACATTTGAG
TGTTTTCATTTTTATTTTAGAAGGTTCAATCAGTCATGACTATCAGAATTTGTAAATTAA
GTTTAGGACTAATTAAGATGGATTAAAATTTGTTATGGTGTAATTGATTTCTAGCTGGTA
ACACATATATTTTTATAAAGATTAATTCTGAATTTTCCTCCACAGAGAGGCCAGCAGAAG
TTTATTTCCTAAGGGCCAGAATCTTCGCGAGAAATGCTGTGTTTAAAGAACACAAAGAAA
ATGTAAGTAAGCTGTCAAACTTCCTCAGTCAGGTCCCCGGGCAGAAATGGTCTCGGGGTA
TTTCAGAAGAATCAGTGTCTGTGGTAGAAGAAAGCTCCCTTGCACGTGCTCCAGTGATGG
GAATATGTGAAGAATCACAAACAATGGTTAGAAGCAAAACAAAAACGAAAAACATGTTGA
ATCTGATTGGCACAGTTGACTTGATTCATAAGCTAGAGTCACCCCTTTCATTTCCGAATG
AGCTAACACTATGATTTACTTTCTGTTACGAGAGCTTAAGCATCTCCATTGCAGTATCGC
ACTGATAATGGTTTGTGTGCCCACACCAGGAACCTGAAGGCATGGGGTCTGCGTCCTGGC
TTAAAGATGGCTGAGGGCGGTTCATTAAAACCGTGTGGTGAAAGGGAGTAAAGTAAAATC
AACCGTGGAAGCCCCCTGGTGAAAGACTAGATCAGGTAATGTAGCTCGGAAAGAGAACTT
GATTTACAATGTCATGTCTTCTGCGCCATCTTAAAGGAGCATCAGTCTGTTTGCTCCCTG
GGGGGAGAGCCGCTAACGGGAAGGTCGCATTTCCAGAACCTTAGGATGATGTTGCGGGCT
CATGTTAGATGACTTGGTGAAATCTCGGAAGCTGAAGGCGCTGGACCAGTGATGAGTACC
ATGGGGTATCTGAAACAGGAGTTTTGATTAAACCCATATTCAACTCTGAGGTCCAATTGG
AGAGGCGTGTTGGCGACTCCCTGGGTGGGAAATCAGCCGTGTGCGTGGGGCTGGGGGCCG
TGGGGAGGACTGCATTTCCAACTCGGAAAGGAACGAAAAGGGTCAATGCATGGAAAAATA
GAGGACTTGCATTGATAATGAAAAAAATGGAATGAAACCCTGGTTATTGCTCAAAGATAA
TTGAGTCTGACTCTCAATAAATGAATAGTCAATTTGACTGCTCCGGACGGGAACACAGGC
TCATCTGCACGGTGCAGTCTGGAGTGTTTTGTTCGGGGTTGGTGGTGGGCTTTGAACTGA
TTGTTGTATTAGAGAAATGAAAACACATTTTCCCATATAAATTAGTTTGCAAAATAACCA
TCTAATTGGAATCCAAGCAGAAACCCAGATGAGAATGCTTTATATGACAGTGATCATAAT
AAATCCAATTTTAAAACTTATTTTATTAAGACAGTAGAAAATAATCCGTATTATTCTTGA
CATTAAATAACCTAAGTAGTGTCCGTAATCAGTGACTATAGACACAGACAAAGTTAGTTC
AGCGTTTTCGTCTCGCGGATCAGATCACAGAGACTGATGCATTGTTGAAAGAGAAATAAG
GGGTAATTTTATATCTTTGTGTACTTTTTAAAAAATGAGCAACCCAGAGGCCAATTAGGA
ATACATGTTTTGATATAGAGAGACTGACTCACCTTGTTTTCCCGTGGTATTCTCGGCGAA
AATAATAGAGTCTTTTATTTTTTGAAAGGTGCACCCGGAGCTTTCCAAGTCGTTGCAATT
TGGTGCTGGAACTAGTGTTTATCCATTTTGAGTTTTCTTAGAAAAATGAGGACAGGCTAT
TAGTATTCCTGGAAAAATAAAATAAATCAGTAATTGAGTGAGTCCTTAAAGTACCTATAG
TGGAGCGGCGATGGCTGCACCATTAAACCCTAGGAGCTGTGCCCAGTCCTGTGGAAACAG
CGCTAAGGAAAGCGGATCGATCTGGTTACGCAGGCCCTTCCCTGGGTGGGTAGTAAGTCG
AATCAGACGTCTCTAGTTGTTAGAGTTTTTGTTTTGTGTGGAGCCATGAATTTGTTGGTA
TTCATGTTATTTAATAGTAACATTTAAGTTAGTAAACACTAGTGTCAGAAAAATGATGTG
ACTATGAGCTGAAGTGGGCTTATGACTAATCAAGTCCTCTTGACACATTTCAGTTTTGAA
AAGCTAATTCTGTGTTCATTGTTTGGAAAAGTAGTTTTTTTTTTTTATAGAATAAACACC
ACACAGTTGATTTAATCATTCTTTAATTGCCAAGCCTTGGGCCGTTACTTTGGGGACTGA
GCCGCGTACAGCCTGATGTAACTAGGCGCCATCAGTGATGTTCTAGGCTTACACGGGCAT
TATTGATGGGACCCCACTAATGATTTCAATTAAATAAATGCTTAAATAATACATGAAATG
AAGGAATGCCAATTATGAGCCACGAGTGGAATGATTCATGAATTAAAATGTGTGATTAAT
TCAGCGCGGTCCAATTAAGACCGTTGCTCCAGTGAGCGAGGCATTTTGCTAATTTCAGAG
CAGACTACCTGTGGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTA
CGTTGTGAGGTTTTTAGTTGTTGGCTAGCCCAGCTTGTAACTCGTACAGAAAATATAATG
AAAAGGGTATAGGTTGGGCCCCAGTTATGAGAAGGGATTGCTTTGAAGCCAGAGCATGGG
TCACTGACTGCAAAACACAGGTTTCTTGTGCACAGTAATCAGGTCTGTTGGCTTTAGATG
ATCATGGTCAATTAAATAATGTTGCTTATATTGATGACTTTTTGTCCTTAGTTTTGTCTC
ATTAAAGGTAACATTGTATCCATGTTATTTATAAATCCCTGAGTGAATGACTCAATATAT
CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCCCATTGAT
CGTCGATTTTCTTGAGCAGTCTCAGTACCGTTGCCATTCGTCCTAGCCCTGAGATTTTAG
CAGCCTCTTTTTACTTGTCCTTCTCAATGGTGCCTCATTGGAGGCTCTTTCAGGGTCAGG
GGAATGAGACCCATCGTTGTTATTGGTTTTGGCATATGAATACGCCACCGGGAGCTTGTC
AGTCTCTCCCATGGGGGCAGAAAACTCGGTAGCTTCCCGGGTTCTCCAAAGGGGAGAATT
TAGGCTATAAGATGTCTAGATAAGATAAGAATTAGTCTACAAGACTCAATATAAGAGAGC
TTAAGTGAAAGAAGAAGTAGAAAGTCATGCCTGGATTAGTGGTGAATATTGGTGGAGGTA
TCTGAGTCAATACCTTTGCCCAGTAACTGTGAGGTCCATTAGGGAAAGAAAATTCCTCCA
TGTTCTCTCTCATGGAGGGTTCCTAGAAGTTTAGGGAAACTTGTCCCCGGGTATTTGTCG
TTCACTTCTAAGGACTGGTACAATTCAGGTGCATCAGGGTATCTGCAAACGAAACAATAT
GTACATAAATGACAAGATCTACTCATGGACAAATAGCATGTAATAAAATATTATATGAAA
ATAACTCCACACTGAAATTAGTAGGTCAGCATCTTTTACATGTTGCATGTGAGTATCCAC
AGTTAACAGATCGTGTTTTGAGTAGCTTATAATTTGCTTTTTTCCTTTTAATTATGTAAG
GGAAAGTTTTGTGTCAGTTACAACACATTAAATAACCATGCATTAAGTAGGTGTTTATGC
AGATTTTTTTTGTAGCTCCTAAGAAATTATGCTCTTAGGCTAGATTCTTAGACTTGAACG
AAGCTCCCTTGATTCTTTATAACTTCAAGCTCAGTACAAGTGTAATATAAAATCATGTTT
TTGATCTGAGGTTTATTGTGATGCCACTCTGAGTAGATGCATTAAGAAATGTAAATCTAA
ATTTAGTGTAAATCTGCTCTGTACTCCCCAGAGCGTCTGCAAGCAGCTCCTTTAATCATT
CAATCAAAAATTGCTTTCTGAGCACAGAGCATAACAACTAAGATAAGTAAGTCCCTTCCT
TTACATTTTTGGATAGTTTGCTGTGGCATGTTTGCTGAAGAAGTTTGAAGTAATCATTGT
TTACATACATGGTATAAAATACTCTTTATGTTAAGTAGGAGTCAGTCATAGGAACATGGC
ATAAACCAAAATTGATTGAAATTGACACAACTGTAGTATTTTAAAAGCAGCTTCACTATA
TGATTCTCTAAGCAGTTAATTATTATTATTTTTATATTATTTAAAATAGCTAATTCATTT
TATTTTATTTTATTTTGCTTTTTGGGGGCAATGCACAGAGGTTACTTATGGCTCATGCAC
TCAGGAATTACTCCTGACAGTGCTCGAGGGACCATATGGGGTGTTGGGAATTGAACCCGG
GTCTGCCGCGTACAAGGCAAGTGCCCTACCCGCTGTGCTATTGTTCCAGCCCCAGCACTT
AAATATTATTATTTATTGTCTACCGTAGTTGGTTTAAGCACTCCCATTTGGGTGGAATTG
CTAGAAACCGCTTGGGGCAGGTCAAAGGTGACTAAAGATGGTGGTTTAATGATTTTTCAG
TTAAACCATCGTGTAGATAAATTAATGGAGCTTCAGAGGAAAAAGGGTTATTGCCGCATT
CCCCCATAAGCCCTTTACATGAGAATGGTGTTCGTTAGCTTTACAGGTCAAGAATTTTAA
CCTCAACGATCTTGTTTGGGGACTTTTTTTTTTTTTAATTGTACAATCAGTAAATCATTG
AAAAATAGAAAACCTGAATTTCCCAGCATGGACCAGTGATGAGTGTCATGGGGTTTCTGA
AACAGGAATTTTGATTAAACCCATCTGCAACTCTGAGGTCCATTACAATGAGAAATGCAT
TATTGCCTCGGTGGGGACTGAGCCGCAGCACCTTAGTCTTGGGCTTCTGTGGTTTGGGGA
ACGAATCACGTTGTTATAATGCAATTAGCCCACGAAGAACGTGGGGTGTCGGTGCCTAAG
GAGTGAGAGGTGTCTGTAGTATTCTCTGTCACTTTTAGAGCATGTAGGTAAACATGGATT
ATGAGAAAAATAATTCGGGGATTCTGAGTCCCAACAAATTAGGTAATTAAGTGCCAATCA
ATTAGTCAAGGCTCTTATCATATGGGTACAGAACATATGGCCGTCGGTACATAAGAGGCA
AAGACTTTGTTTTGTGTTGAGGCAGATTGCCAACTGATCATTCTATTAGGACCAGGAAAG
ACATTTGCATAAATAGTTGATTGAATAACTATGTAGTTGAGAGGGAGAGCATGGAGCAAT
GATGAGACCATTTGACACAACCACATTTATGATTAGTGCAATATTTTATGCAGTTTTATT
TATGCAAACATTAAAGTAGCCAGTTGCTGTCCTCGTGGGAAATCCCAGAGAGACAAAGGC
AGACATTACTCAGACTCCTGACCCAGCACACGTGTGCTCCCGCTCGGCAAAGTAGCGCTG
GATGTGGGCACAGTCGTACACTTCACCTCAATACTATCTTAGAAAATTCTGCCAGAACAC
ACCGATCGCCAGCAAACGTTGCGACTCCTCATGTCTTAAGCAACGTCTGTCTTTGGGACC
CAGGGCTTAGTCTTCTCCTCCGGACACTTGGAAAGAGCAATATTTTCCCTCTGCTTCAAT
GGCTTAAACTTCTGGGAATTCTTTTAGAAAAAGGAAAGAAAGGTGTGATTATCCCGTGAG
TGAGAGGTCTATTAGTGAGTGAGTTAAGACATATACTACACGTAATATAATCCAACATAA
TCCACACAACTCAAGTTCAGCGGAGAAGAAAATTTTGACTTTTAGCGATGGGCAGCAATT
ACAGAGAGGTACCTCCAATACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved