Sorex_araneus Locus Mono:847:SNORA16
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:847:SNORA16
Sorex_araneus
Mono:847:SNORA16
GeneScaffold_6162
SNORA16
1001..1135
2135
AATACTTGCATGGGGTGAATGCATACAAGCCACCAGGCGCTTCAGCCAAGATGGACTAC
AACTCCCAGCTGGCTGTGCGTCCCCGGTACGCTATTAGTACGTGCCATGAGATGCTGCAG
CCGGGATGGACTACAACTCCCAGCGGGCTGTGCGTCCCCGGTACGCTATTAGTACGTGCC
ACGAGATGCTGCAGCCGGGATAGACTACAACTCCCAGCGGGCTGTGCGGCCCGATACGCT
TATAGACCGCGCGGCAGCGAAGGGCGGAGACTATATAAGCTCCGTCCCGACGCTCGCCCG
CCCTTTCGAGCAGGTTCCCTGTGTGGGCCTGTTGGTTATTCGGGAAGCAGCTGCCCGCCT
TCCGCACTCTCTTAGACTCCCTCTTCTCCCCGCGGCCTCCAGCTCTGCTCCCATCCCGGC
ATGTTAAGGGCAGCACGGGATGCCCGGGCCCGCGCCCCTCGCGGAAGCAGCGCCCCGCGG
GCCGTGTCCGCCACGTGTGCAGTGGGAGGCCCGGAGCCTACGCGGGCCGCGCCCTTCGCC
CCCGCGCAACCCACGGCCCCGGTGAGTAACTGGAGTCGGGCCTGGAAGCCCCGTGGTTCT
GGGTCTGAAGTGGCTTTATCAGAAGGAGCCACGAAGTGATGCTTTGAATCTGCTCGGGGG
AGCTGCCTGCTGGGTGGACCCCGGGCAGAGGCCGTTGTAGCACGTGGTAAAGGTCACCTT
GGTGGGTGGATATGTCAAGGAGGACGGCTGGTATCCAGATCCCACTCTGAATACGGATTT
TGCCACGTTACATTGATAGGTCAAATTCATCAATCTACATGATAGGCCTGAACTGCTCTT
TAAAACGGTTATATGAGGGCGAAGATCAAGCGAGTCCGCGCTAGTCACCTATGGAATGCC
CCCGAGACCCCAGAAAGCCCAGCAGCCGAGTTAGAGGAGGCCACGGCTACTTCTGCAGAC
GATTTGGGTGAGTGCGGGTTCAACTGCAATTGGAGTTGTCATGTGGCCCTTATCGAAGCT
GCAGCAACTTCCACATAGCTGCTGTGGTCAAAAAGGAGCCCAGAGTGACAGTTTTCCTTG
ACGGTCGCCGTTCTGTTTGTAGTAACTGATCTGCAACATTTCGGGAAAAGACAGTTTCCG
CTGTGTATCTTAGTGTTAGTATATTTTGGGGGCACTATATGTGGTTTTGGGGATCAAGTT
GCTAGCTTCAGGCAAGGCAAGCATCTTGTCTGCTGTATTATCCTTGACCCTATCTATTTA
GAAAAGCATGACTGAACGGAATTCATGGGGAATACAATGCTGCAGGCTGGAGCACATGAT
TTATTTGCTTGGCCCAGGTTTTACTCCCCACGCTACGTTGGTGGGAACTTAATGATCTCA
CTTCCAACAAACTTGAGTAATTGGTTGTCTGAAAATGGAGGAGAGGGAGGTTGGTTTGGA
AAACAAGGGAGCAAAGATCATGAACTAGTTTTGTTCTTTCCCCTAAAAAGGAGACGTTCT
ATCAGCAGAAGCCAAAACCTTTGAAGCCGTGATAACTTCGATGCTGATGTCTAGATGAAG
GGAAGAATATCTAGCAGGACAGTTGTTCTTAGCTATGCCGAGTGAATACTTCAGGCTTTC
TGGTGAGTGAGGAGTCTTGGGATAAAGATCCACAGCCTTACACTGTGCTCTGGCCTTGGT
TGTTTTTTTTTTTTTTTTTTGGGCTGAGACATAATTTGGGGGTTGCCTGGGGGAATTAAG
GAAGCATGTTTCCAAGGTCTGTGGCTGATAGTGTCCACGGTATCTCCAACTGCATGCGAG
AGCAACCTGGAGAGACTTTGACAGCACAGGTCACCAGTACCTGCAGCTGCCACTCGACTT
TCCTATAAACTAAAGAAAGGTTCTGGCCCTGAAGCCTTCAACCTTAATTTGTTTTAGCAT
TATGTACCATGTAGTCACGTGTATCATATCAACTGTTAACTGCTAACATTTTTTGGTTGC
CACTAGGTTTTCTGCAATAGATGAAACTAAACCTGAATCACAACTGGTCGCTGAAACTGT
TCCTTTAAAGGTAAAGTTAGGTCTGGAGGACTTGCCTGACCCTCCTGTTCCCTTTCCCAT
CGGATCTGAACACTGGTCTTGGTGGTCGTAAAGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved