Sorex_araneus Locus Mono:600:SNORA51
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:600:SNORA51
Sorex_araneus
Mono:600:SNORA51
scaffold_237588
SNORA51
1001..1132
2132
CCCCTAAAGGACCCTTTTGTCTAATGACACCTGTGACATATACAGGTGATGCACCAGAG
ACTTTTATACAAAAAATACTGCCAAAAACAGTAACAACAAGTCTCACAATGCAGATGTTA
CTGGTGCCTGCTCAAGCAAATCAATGAACAACTGGACCACTGTGTGACAGTGCAGTGCTA
CTACCAGCTTGAACTGGAAAGGATAGAGATGGGATGAAATGAGAGAAATCTACTGGATTT
TCACTCTCTGCAGGCAGGAAATGGGCTGATAGAACTACTCAATTATAAACATTTGCTATC
CCTCAATAAAAGGAGGGATGAGGTGTCACTATAGACCCAAAGCGTAGGGCTCCCATGGGC
TCAGAAGTTGGCACTAGTGTAGACCCAGAGTAAATATATAAATATCTTTATAAAAGATAT
CATGGGCACAAGAGGGTGTATGGAGACATAGAGGTTAATCTTGGAACTTGAAATGTAATA
AAGTTTATTCTTTTAACTCTTAGCACTGGTTACCTCTTTATTCTTTGGAAGGGAAATGTC
TACCCTATAATTGTTCCATCATTGTGTCTGGAAGAAGATAGTCATTTTCTAGTCACTAAG
TCCACAGATGCTAATATTTTTTTGCCAGGTTGGACTCAAGTCTCACTCATACCTGATTTA
GATTCTAGATGGAACTTTTGGAATAGATGATATGTTGAACTTGGTTGACACAGGAATGAG
GTAAAGTTAGAGTGTGTGATTGGTTGAATATATTTTGCACATGGGAAGGTCATACATTTG
GGAGGATCAGAAGGTGGAATGTAAAGGATTGTATATTTTATCTAAATTTTATGTTTGGTG
TCTATCAATATAGCTGTATTTGGAAATAGAATATTTATGAATATCATCATTACCATTTTG
ATAATATAATTGAACTTTAAATCCAGTGACTGGCATGTTTAGAAGAGACAGGAGGAAAGA
AAACAATGAGAAGCCCAAGTGAAGATGAAATAGAGTCTGGTGGCTTCCGAGTGCTTACCA
CAGGCTTGTGCTTTGCATCTACTGTGGAGAAAGAGGAAGCACAGTAATCCTAGCCCACAT
ACACCCCAGCCCAGGCCCTTTGCTTGGTCTTTATTGTGAATGGTAAGGCCTTGGGGGACT
GAAATTGTGCAGCCAACGAGAATCTAGTGCTATCAGATTCTTAAAAAGAAAAACCTTCAC
CCCTAGAAACTTTGGAGGGAGCAAATCCTTGCAGACATTTTCAGTTTAGACTTCCAGCCT
CCAAATCTGTGAGAGATAATAAATGTCTGTTATTTTAATCCATTGAGTGCCTGCTACATT
GCTAAGGCAGCATTAATGAGCTCGTATAGATGTTTAACCCAGAGAGGTAGTAATTATGAA
TATCCTTTGACTAATCATATTTCAGATTTATCTCCATACCAATTGCATTAGCATTAGCTT
CCCCCAACAGTTCCTATATTTCTGACAACAGTTGGCATTATCCAGCTTTAATTTTAAGTA
GTCAAATAGGTATTAAAAGTGATGTTTCCTCTCTAAGAACAATAGTGAGTTATGTGTTGA
AATCTGGAATGTAATCAAGGTAAAGAGAAAAGGAAGTGAAATTATCACTCACCTATGGGG
TGGGTTGGGGGGTGAGGGGTGGGATGTATACTGTTTTTTTCTTTTGTTTGTTTGTTTTGT
TTTTGCTTTTGTTTTTGTTTATATTGGTGGTGGAATATGGGCACTGGTTAAGGGATGGGT
GTTTGAGCATTGTGTAACTGAGATATAAGCCTGAGAAGTTTGTAACTTTCCACTTGGTGA
TTCAATAAAATAAATAAATTAATTAAAAAAAATAAAAAATAAAAAATAAAAGTGATGTTT
CCTCATTCTTTTAATTGTCTATTTCCCTGATTTCCTGTGATATTGAATATCCCATGGCAC
TTGTTGTTAGCTTTGTGGATTCCTTTTTTGGAAATCGTCTATTAATAGCTTTTGCAGATT
TTCCTATTGGTACTGCTTTCTTCTTCTTAAAGGCCCTTAGAAATTCCACATATACTTTAC
TTCTGTATGTTTGTTTGTTTTGGGTGCCATACTGTCTACACTTAGGAGTTATTCCCAACT
TCGTACTTGTCTGTTGCTCCTGGAAGTGTAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved