Sorex_araneus Locus Mono:269:SNORA18
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:269:SNORA18
Sorex_araneus
Mono:269:SNORA18
scaffold_183429
SNORA18
1001..1112
2112
CTAAAGATGATAAAATCTTGTTGTTTCAGCAGTAGTATTACTGTTTGCACTATTTAAAA
TAGATTGCTTCCTCCTGAGTTCTGGTACACTCCTTTATACATCACTCAAGTATTTTGGGA
AGGAATGTCATTTCTTCACATTTATTTGAAAAACCAATTCCTATGACCATTCTTTCTATC
CCTATTATGTGGCAGATCATTGCCAAATGTCATTTCTATGTCACTTTGAACTGTGAGTTT
GTGGACCCAGGATTTGGTATAAAATTTTTCCTTCTCTTAACTAGACAACTTCAGTGATTC
ACCAGTGTGGCCCTGGATCCCATCATTGGCTGACATAGCAGCTGTGTTTTTCAATATGGG
AATTGATTTTAAGTCTCTGTTTCCTCTGGAGAATCTTCAGCCAGACTTTAATGAAGACAA
TCTAGTGTAAGTTTTCTTTTCAAAGTTAACTCATAAAGATTATTTTAAATAATTTGCATA
TATCCTGATATTCATTTGGTAATATGTTCAATATCCATTCTTGTTTTTATTAAAGTTGAA
ATGGATCTTGAACTAATGTCTTCTTAATACCTGTCAATCTGTAAAACTGTCAGGTTAACA
GGGAAATAAGCACTCTCATGTTTTGTTGCTATAATCTTAGACTGTTTTATTACTATAACA
ATGTTAGGTTAAGAATAATGTCCTAATTGGCTTTTTCTACTCTAGAGAAGTCTGCCTTCT
CTCTTCAACATATTCTCTTTCTCCCTTCACATCTAAGTAAGTTGTGTTTAATAGAAACTA
TCTTGCTTCACTTAAAATAATAATTATAAAGTTATAGTCCCAGCCCCACATATAGTGCCC
CTGAGCCCTGCCTGGGAGTGATCCCTTAATGCAAAGCCAGGAATAAGCCCTGTGCAATCC
CTGTTGCATTTTCTATTGTGGGCAGCCCCTCTAAAAATGAATAATGTAACAAACTATTGT
TATTTAACATTGTTTTAGAACTACTGACCAAAGAAATTAGACAGGAGGGTAAAGTAAGAC
AAAAATTATTGGCAGTGCCTCATAAAAGTATTTTGATTTGCTTTACTCGTAGGACTACTT
GTTAGATCTGTGGGGAAGAACTAACATACAGCTGATGAGAGATGAAACATCTGATGGTCA
ATTTTTTTTTCGTAGGTATTGGCTTATCAGCAAAGATGTTGTTTACTGTTGTGTAGGGTC
TGATAGTTAAATGATCTTAAGCTAGTCATATTTTGAGGATGCCTAAAGTTGTTAAGCAGA
TTCATCTGCTCCAATCCTGAAAGATGACTCTAAATTGCATTGGGCTGGAGTGATAGTACA
GCCTGTAGAGAACTTACCTTGCACACAGCTGACCCAGGTTCGATCTCTGGCATCCCATAT
GGTTCCCTGAGCACTCTTGAAGTGATCCCTGAGTGCAGAGCCAGAAGTAACCCCTGAGTA
TCACCAGGTGTGGCCCCTCCAAAAAATAAAGTTAAAAGTAAAAGTAAATTGCATGAAGAA
ATCAGATCCTGGTAATTATTGACTGACATATATTACAACTGGATTAAGTAGAATTTGTTG
TTGGGACATTTTGAAGACAGAGATTCAAATGTTAGAGGAAGTGATGGATTGGCAAGGAAA
AAAAAGAACCACATGAAACGACGTAAAAATTTATTGATGTTTAAAAAAAGATATTAGAAA
TGAATTGTTAAAAGATTCACTATTTACAGAAGTGATTTAGTTTATAGATAGAAGACTATA
GATAAATTGGAAAGCAGTTAAAAGCAAGAGAATTTGATATGGATGCTAGGATAAGGTTAA
TAAAGAAAAATCAGTAACTATTCTAAAGATATATTAACTATCATTAAAATATAAACTGAA
AAATATAAAATACCAGGGCGTGGAGAGATGTACAGTGGATAGGTGCATGTGGCCAACCTG
GGTTCAGTCCCTCACATCCTCTTTGGGCACCCAAGCACTGCCAAGAGTAATTTCTGAATG
TAGGTCCAAGAGTAAGCCCTGAGCATAATCAGGTATGACCCCAAAACAAACCTAAAAAAA
CTAGGAATAAATATTTTTTTCTTCTATTTGGTTTTGGGGCCACACCCAGCAGTGCTCAGG
GGTTATTTCCATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved