Sorex_araneus Locus Mono:760:SNORD42
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:760:SNORD42
Sorex_araneus
Mono:760:SNORD42
GeneScaffold_1659
SNORD42
1001..1068
2068
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGTTTTTTT
GTTTTCTAATGTTAGAAGAGTGTATCGGTCTTTCCCGTGCCATGCATATGATGGAAAAAA
TTTTAATCTCCTGAGACTTGTGATGTCTTCAAAGGAACCACTGATGCACGTTTGGCCAAG
AGGTGCCCTCCCGGGCCTTCAGGAAGTAATCGCTTTCTCACCCCCTCCTTACCCCCGCAA
TCACGTTACGTTCTTTTCTTGTCTCAGCCCCTGCCCCTCCCAAAGTTGAAGCCAAAGCCA
AAGCTTTGAAGGCCAAGAAAGCAGTGCTGAAAGGCGTCCACAGCCAGAAAAAGAAAAAGA
TCCGCACATCACCCACCTTCCGAAGACCCAAGACCCTGCGGCTGAGAAGGCAACCCAAAT
ACCCTCGGAAGAGCGCCCCCAGGAGAAACAAGTCAGTATTACAGCATACTAAGAGGAGTT
GGTCACTGACCAGTCTACACGTCTAGATCTTGGGACCTCAGAAACATGTTGTGGGGCGGG
AAAGATTGTATAGCGGTAGGGCGCTTGCTCTGCATGCAGAGGACTCGATTGCGATTCCCG
GCATCTCATGGTTCCCTGAGAACGGCCAGCAGTAAAACCTGAGCATCAGAAATTAATGCC
ATATTACTGTACTTGGGACTTGTATGAGAGGACGCTTATCTCGGGAATCGAACTCGGGAC
CTCACATGTGACTCGACTTCCCTAAGATGTTCTACTAGGCGTGTGGAGGTGTGGAGATTG
ACATTTAAGAACAGGAGAAGGCTTCTCCCCGCCCTCTCCCCCAGTGCTTTCAAGGTTAAT
TATTGAATTATTATGGAATTAATTTTGTTCGTACTGGTCAGGATTTTATACTTAATTTTC
TTGGGGATGTAAACTAAGCCTTTAAAGATATCAGTGGTCTTGACTAGCAAGGTTAGGTGT
AGCTTTCAATGGAGAAGATATGGAGTAAGAAGAGAGGATAAGGGAAATTGTTTATGTTGG
GTATGAAACCCTTTATAATAGTGCATGGGAAACTTTCCATCAAATTTTTACACAAAGAAG
GGTTCGACCTGGAGGAAATGAGCAAAAGGTTAGCATACTGAGGAAGTAGGTTATTATTAA
ACAATTGATAACTGACCAGGTTTGGGCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved