Sorex_araneus Locus Mono:714:SNORD72
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:714:SNORD72
Sorex_araneus
Mono:714:SNORD72
GeneScaffold_1956
SNORD72
1001..1080
2080
GCAGATTCCGGGTGGCTTTGGGCTGGCCGTGCACCCTGGGGCACGGAGCAGGTCTGAGG
GTTGTTGCTGAGACACCTTTCCCAGTGGCTGGTTGTTAAATAAGGATAAGGATGCCCTGG
TTTAGGGGGGGGGGGAATCCCCAGGTTTCTGACCCCTGGTCCCCCCCTCCGATTGTCGCT
GTCACCTTCAGACCAGTTGGGCTGATTTTTGGTGAGCAGTAAGAGGAGGTGGAGACATGG
AGGCATGGAGTTGTTTGGGCAGTGGGCTTGGTGGGGTCCTAACGTTTTGTCGTTCTGGTC
AAGTCTTAACTGTAGGAAGCCAGTAGTTTTCATGTTTAGAAGTGTCACTTTTGTCCTGTC
GCCTAAAATCTGGCATTGGAGTTCGTGAGAAATACGGGGTTTCAGCTCCAACCTAAACTT
GGAAATACTCCTGTTAGAGTAGCTGTGAGGGGACCACAACCTGTATGGCCCAGAACTGGG
CAGGACTGGGTGGGCCTTAACCCACCTCTTCCCACTGTACTATCTGGGCCGGACAGCAGC
GTTTAAAGGGTTAGCCAGCCTGCGGTCTTAGCTGTCATCCGCGTGGGCAGATTGCTGTCC
AGTGCCACAGAGAGTGTTTGGCAGATTTGTCACTTCAGGTGTTTGTGTTCCTGTGCTGTG
CAGTAATGACGGGCAGGTACAGAAAGGTCCCTGTAACATAGGGGTTACAAGCAGGAACTG
AAGTGAGACTTGATGGATCTCACACTTTTTGGCAGGTAGATAATAATGCCTTTACCTTAG
ACTATGTGTGGGTAAAAATATAAAGCTTAATTGTGCCATTTAGAGAATGCCCTTCATCAA
GCATGCTCAGCAAACATGAAGTGAGTTAGGATACCCTACTCCAGCATATAGATGCATTTT
TCTCGTTATTCTATCTCTGATGAAAAAAGACCAGCCTGGTACAAGATAGTGCCAGTATGT
GTTCCTAATATAGATCATTTGAATTAGGTGGGATTGGTAGCAGCTTATCGATGATGTTGC
AAAAATAAATGTCTGAACATATGAATTCAATACTGATTTCAGCATTTAACTGAGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTGCTAATTACTGAGTTTTTTTT
TAATCCACCCAATAAAACCATGAAATTTACTGTGGTCCCCAACGTCAGGTGACTTAGTAA
ATGTAGGCAGGGCCCAGAGCAACTTTGCTAAGTATCAAGATAGGAATGAGTTGGTCTGAA
GAAGGGTGTAGGAAGCAAGACATTGATCTTGCATGCAGCGGATTCTGTTCCAGGATCCAG
CATATATGGGGCTTGAACACTGCCATGTGTGGCCCAAACTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved