Sorex_araneus Locus Mono:296:SNORA15
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:296:SNORA15
Sorex_araneus
Mono:296:SNORA15
scaffold_185215
SNORA15
1001..1139
1331
GAATGGACTGTTTTGGTTGTTGAGTCAGCTTCTGACCCAGAGTCTGGTGAGGGGTGTCT
GGAGTTGCTTTAGTTGGTTCTTAGGGAGGGAACTTTCCTGCGGAGCTGTTGGCGGCTTCT
CGGATTAGCCCCAGCTAGTGCGTTGGTGGTGGAGGTGGGAGATGGAACGTCAAATCCATA
GGTCAGTTGGAGGGAGGAATATTATTCCTGCCACAGAGTTGGGAACCCCTAGCAATAAGG
TGAGGTAGGAAAAAGAATGGCCCACAGGGCTTATCATGAGAATGGCAGTTCTGACAAATT
GTTGTGGCTTCTGAGCGTTTTTTTTTTTTTTTTTTTTAAATACAAGACTGGGTCATGTTT
TAGTTCAGTGGAAAAGTATGTTGTAACTGAGGTCTGCTTTAGCTGGAGAGAGTCTAGCTA
GGATGATGGCCAGGTGTGTGCCGTCCCAGGCATGTGGAGTTGGCAGTTAGCTTGCTCTGC
ACTGGGGCCCTTAGCTGTCAGGCCTGAAAGAACTTGATGAATGAATGAACTGTTTGCTGT
TCATCATAGGTCTGATTCTCCCTCCATTGGTGGGCTACAAAAATGGTACTGATGCAGTGT
TGATTTCCCCAGATTGTTTGATATTGTTTTTAAACTTTGTATTTTGTTAAAAATTTTCTG
AAAATTTGTCTAAAATTATTTTTAGAGCCTCTGTAAAGTGTATGCAAATTAACAAATCAG
AATTGTGAGATGTGCCTCATTGGTTAGCTTGAAACAAACAGGTTGTCGTGGGTGTAGCAT
TTGCCCAGTGTAGACCCATTGGTGCCTTTATATGTTTATAATTAATCCTTACTCTCCCGG
ATAGTGGCTAAATCATCCCCTGGAATGTGATTCTAAATGAGATACGTAATCAAAGAACTA
TGTGTTATCCTGTCATTTCATGCCTTCTGTTTTCATGTCTTTGGACAAAGCAGTTAACAT
CTTCAAGCTTCACTTTTCTCATGGTAAGAAAATAAAAGCAAGCATGGCTGAATACTGTGT
TCTTTTTTTACCAATATTTTACACAGCCAGACACCGTGCAAAAATAAAGTTCTTCTTTGA
AATGGCTTTTGATAGTATGCAGCTTTTTCATGGCATATCGTTATCAAAGTAGCTACGAAT
AAGTGAGAAAAAATAGAAAAGAGAAAGAGCTGAATACACTTTTTACTAGGCCTTCACAGT
ACAAAGTTAGAAAGGTGTATTTTAATGTTCAGCCCCTGAAAAAAAAGACAAATGTCAGTA
TGTATGCATTGATTTCACTTTTCCCCCCTTGAAACTATCCAGACTAAGATTTGAAGATGC
CAAGTAGAAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved