Sorex_araneus Locus Mono:77:SNORA2
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:77:SNORA2
Sorex_araneus
Mono:77:SNORA2
scaffold_131743
SNORA2
1001..1132
1929
TGGAACCTTGAGCCAGGGCCGATAACAGCGTATTACTTTTGGTTCCAGAAACTGCTTGC
GGACATTGTACCAGACTATCAACTAAGCTAGAGCCCCACGCTGGCTGATGACGAGAAATA
ACCATCTCTTTTGGTTTGTTTCCCTTTGTCAGGCAGCGTGGTGATTACTAAACAGGCGTG
ATCTCGGTGGCGCGGGACGAGGGGGGAAAAAAATAGAATAGTTATGTAACAAACAGCGGG
ACTTAATATCTCTACATTCTCAGCAATGGAGAGCCATCAAATGCTTCCTTGACAGTGGGA
CTGTCTTCTCTTTTTTGGGGGGAAACCCTAGCAACAATAGTGAATTATGTGTTGAAACAT
GGACTGTAACCAAGATAAAGCGTAAACGAAGTGAAACTTATCACTTACAAGGGCGGGGAC
TGGGGGGGTGGGAGGGGGCGGGAGGTATAATGGGGTGGTTGGTGATGGAATATGGGCACG
GGTGAAAGGAAGGGTGTTTGAGTACTGTATAACTGACATAATCATGAGAACTTTGTAACC
CTCCACATGGTGATTCAATAAAATTTAAATTTAAAAAAAAATTATTAAATTTTAATAGCA
ATTTTTTAAAGTGCTGGTTCAGACAGATAGCACAGTACATAAGGTTCTTGCTTCACATGC
ATATGACCTAGGTTCCATCCAAGGTATCACATAAGGTCCTTTGGGCATTCCAAGAGTAAA
TCTTGGGTTCAGAGTCAGAAATAATGCTTAATGTAACTCCCAACACAAAGAAAAAAATAT
AAAAGTCATAGTAGAACTTCGGCCCTGGATCAAGACCAACAGCTGGCCGAGGCTGCCGTT
TCAAGCAGGAGCCCAAAGGAAGTCTTTCTATGGTCTGTTGATCACGTCCGAGTGTCCGTG
GCGTGGTCAGTTCATTAAAAAGAAACAGCCCGCCGCAGTGAGGCATCGGGCTTTGCAGTT
GGGTTGGCGGGGAGGGGGGGGAGGAGCAAGGGGGGTCGTGACACATTGTATCCTAGGCTG
TGGTCTAAAGCCATTTTCGCTAGCTATAAGCGGGGCCTCCAGAACCAGAGGGAGCACACG
GTTCTTCTCAAGATCTAAGGCGTTTATGCCTGCGTTGAAACCGAGTTCTACCTGGGCAAG
AGGCGTGCTTACGTCTACAAGGCGAAGAACAGCACAGTGACTCCTGGCGGCAAAACCAGA
GTGATCTGGGGAAAGGTGACCCGCGCCCATGGAAACAGTGGCATGGTTCGAGCTAAGTTC
CGAAGTAACCTTCCTGCTAAGGCAATTGGTCACAGAATCCGTGTGATGCTGTAGCCCTCA
AGGATATAAACTTACTGAAAAGTAAATAAATAAAGTCTAGATATTTTTCTCGTTAAAAAA
AAGTTCTAGTAAAACTATTTATCATTACAAAAGAAAGAATATTCTTCAAAACTTGTCATA
TAGGAGCAGCACGACTATTTTCAATCCTTGGAAAGAATGCACTTGAAGCACTGTCATCCC
GTTGTTCATCAATTTGCTTGAGTAGGCACCTGTAACGTCTCCATTGTGAGACTTGTTACT
GCTTTTAACATATCGCATATGCCTTAGCAGAACTTGACAAGAACTGAACCCGGGTGGCCG
CATGGAAGGCAAATGCCCTAGTCACTATGCTATAGAAAAAAATATATAGATCCATCACCA
TGTTGAATAAGAATACAAATATATGAAGAGCTAACACAAATAAGTTTATTTTAGAATGTA
AAATAAAGTTAATACGTGAAAGTCAGTGGTTATATTTTCCATATGAGATAAATGAGGAGG
AAAATTCTGATTATTTCAAGACATAGAGAAAATGTAAAATTTAACCAATTCATAAAGAGA
AAGAGAAACAGACACACAGAGAAAATAGAGGGATCAAAGGGAAAAACAAAAGGGCAACGA
ATAAAAATAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved