Sorex_araneus Locus Mono:104:SNORA42
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:104:SNORA42
Sorex_araneus
Mono:104:SNORA42
scaffold_139040
SNORA42
1001..1129
1181
ATATTGCCTCTGAACTATGTTTGATCCAGAGGTCTATTAAGAAATTCCCCAGAGGGGGC
TGGAATGATAGCACAGCGGGTAGGGCGTTTGCCTTGCACGCGGCCGACCCGGGTTCGATT
TTTAGCATCCCATATGGTCCCCCATGCACCGCCTGGAGTGATTCCTGAGTGCAAAGCCAG
GAGTGACCCCTGAGCATCGCTGGGTGTGACCCAAAAAGCAAAAAAAAAAAAAAAAAGAAA
TGCCCCAGAAAAACAACTTGAACCCAGGAGGGAGAAAACTATGTCCTTTTATCCTGCAAA
TAATTCTCCAGACACACTGGAATAGTTGGTCATATATTACTATACATTTTTAGTCAATGT
AAATTTATATTAAAGCCAATATTATTGGACTGGAGCAATAGCAGAGCAGGTAGGGTATTT
GCCTTGCACATGGCCAACCCGGGTTCAATTCCTCCATCCCTTTCGGAGAGCCTGGCAAGC
TATCGAGAATATACCGCTCACACAGCAGAGCCTGGCAAGCTACCCATGGCAGATTCGATA
TGCCAAAAACTGTAACAACAAGTCTCACATTGGAGACGTTACTGGAGCCTGCTCATGCAA
ATCAATGAACAACAGGACGATGACAGTGCTAATATATAATTATTTACTCTATTATCATTA
CTAAATTCAGGGGTGAGGACTTACATTGTTTCCTTAAGACTAGTTTCTTGTAAGATTACA
CAGCTGCAGTAAATTTTATAATGATCCCTCCTACAAGAAAAAATAAATGTGATACAAGTA
ATGTCCGAAGGACAGAGATACTGAAGATGATTCCTGGATATGTTTTCTCTTTGCCTCTTT
TCATCTGTGGTGGTTAGTCATCCTCTCCGATAAAATCAAGGGCTCAATAATGAGCACAAA
GAGACTCAGGAGAGGGACTTGTAAGGGGTCATGCCAGCACTAATAAATGTGGAATACCCA
TTTCTAAAAATGTTCATGTTGCACCTGATTAATCAGGTGAAGTGTTCACCTGATTAATGG
CAGGCTAGTCACCCTGAACCTCTCAAAATGCCCCATGCCAGATAAAATTATGGCCATACC
ACTGACTAGCCTTTGCATGTGGGCTGTAAACACTGATACTACAAAAATAAATAAATAAAA
TTTAAAAATGAAGATGTTAATGAACCATGGAGGGAAATACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved