Sorex_araneus Locus Poly:11:SNORD116
snOPY snoRNA Orthological Gene Database
Sorex_araneus Poly:11:SNORD116
Sorex_araneus
Poly:11:SNORD116
scaffold_234385
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1001..1101, 1733..1833, 2465..2565, 3196..3296, 6181..6281, 7043..7143
8143
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCTGCTCAGGTGGAGTTTGCCTGCCAGGCTTGGAATGTTCAACGGGTGAGGGGGCC
TGTTTCTCCAACGTGGAGATTGATGATATACCTTGTCATTTTGGACCCGAGAGCTCTTGA
ACACAGACCCTGTAAGGAAGCTTCTTATGCTTACAATAGGCCATCTGGTATGCCTTATCA
CTGATCTTGGACCCTTCCTCTTGGCTGTGCATTAATTTGCCAGGGTAGCTACTTGTGTGA
GGCACAAGCTGATTATGTGAGGCAGCTTCTCCATTGTGCTTGGATCGATGATGAATACCC
CTAACTCTATGCATTCCTTGGAAAACCTGAACAAAATGAGTGAGAACTCACACCACCGCC
GTTCTCATCGTATCTGAGGTCCAGCACGTGGTGAGCCTCACAAATGGTAGGCTGAAAAGG
CATGTTTACCTTGGTTAATGTCATGCAGCACCATCCAAGACCTTTGTTTGAGGAGTCTGA
GGGCACTTGGCCTTTCCAGGCCCTGGATTATGTTTTCCATGTAGGATTTAAGTATCATAA
CCCTAACAGGGTCATTTGTTCTTTTCTGTAGTCATTCCTAGTCTTGTACTGTGTCCCATG
CCTGCTGTCCAATTTATGGCTACTGGTTTGTGAAATCAGGAAGATGCCAGTGCAGGCAAA
AGAGTATCCTTTGATTGTGATATCTTCTGCCTGGTCTCCTGGAAATCTCTCATGCATCCT
GTGTTTTGTGTACCCTGCTCAGGTGGAGTTTGCCTGCCAGGCTTGGAATGTTCTAAGAAA
GGCTTCCTGTTGTCCCCAACGTGGAGATTGATGATATACCATGTCATTATGGACCCAAGA
GCTCTTGAACACAGACCCTTCCAGTAAGCAAGCTTCTTATGCTTACAATAGGCCATCTGG
TATGCGTTATCACTGGTCTTGGAACCTTCCTCTTGGCCATGCATTAATTGGCCAGGGTAG
CTACTTGTGTGAGGCACAAGATGCTTATGTGAGGCTGCCTCTCCACTGTGCTCGGATCGA
TGATGAATACCCCTAACTCTATGCATTCCTTGGAAAACCTGAACAAAATGAGTGAGAACT
CACACCACCGCCGTTCTCATCGTATCTGAGGTCCAGCACGTGGTGAGCCTCACAAATGGT
AGGCTGGAAAGGCATGTTTACCTTGGTTAATGTCATGCAGCACCATCCAGGACCTTTGTT
TGAGGAGTCTGAGGGCACTTGGCCTTTCCAGGCTCTGGATTATGTTTTCCATGTAGGATT
TAAGTATCATAACCCTAACAAGGTCATTTGTTCTTTTCTGTAGTCATTCCTAGTCTTGTA
CTGTGTCCCATGCCTGCTGTCCAATTTATGGCTACTGGTTTGTGAAATCAGGAAGATGCC
AGGGCGGGCAAAAGAGTATCCTTTGATTGTGATATCTTCTGCCTGGTCTCCTGGAAATCT
CTCATGCATCCTGTGTTTTGTGTACCCTGCTCAGGTGGAGTTTGCCTGCCAGGCTTGGAA
TGTTCTAAGAAAGGCTTCCTGTTGTCCCCAACGTGGAGATTGATGATATACCATGTCATT
ATGGACCTGAGAGCTCTTGAACACAGACCCTTCCAGTAAGCAAGCTTCTTATGCTTACAA
TAGGCCATCTGGTATGCTTTATCACTGGTCTTGGAACCTTCCTCTTGGCTGTGCATTAAT
TGGCCAGGGTAGCTACTTGTGTGATGCACAAGCTGATTATGTGAGGCAGCATCTCCATTG
TGCTTGGATCGATGATGAATACCCCTAACTCTATGCATTCCTTGGAAAACCTGAACAAAA
TGAGTGAGAACTCACACCACCGCCGTTCTCATCGTATCTGAGGTCCAGCACGTGGTGAGC
CTCACAAATGGTAGGCTGAAAAGGCATGTTTACCTTGGTTAATGTCATGCAGCACCATCC
AGGACCTTTGTTTGAGGAGTCTGAGGGCACTTGGCCCTTCCAGGCCCTGGATTATGTTTT
CCATGTAGGATTTAAGTATCATAACCCTTACAGGGTCATTTGTTCTTTTCTGTAGTCATT
CCTAGTCTTGTACTGTGTCCCATGCCTGCTGTCCAATTTATGGCTACTGGTTTGTGAAAT
CAGGAAGATGCCAGGGCAGGCAAAAGAGTATCCTTTGATTGTGATCTCTTCTGCCTGGTC
TCCGGGAAATCTCTCATGCATCCTGTGTTTTGTGTACCCTGCTCAGGTGGAGTTTGCCTG
CCAGGCTTGGAATGTTCTAAGAAAGGCTTCCAGTTTCCCCAACGTGGAGATTGATGATAT
ACCATGTCATTATGGACCCGAGAGCTCTTGAACACAGACCCTTCCAGTAAGCAAGCTTCT
TATGCTTACAATAGGCCATCTGGTATGCTTTATCACTGGTCTTGGACCCTTCCTCTTGGC
TGTGCATTAATTGGCCAGGGTAGCTACTTGTGTGAGGCACAAGCTGCTTATGTGAGGCTG
CCTCTCCACTGTGCTTGGATCGATGATGAATACCCCTAACTCTATGCATTCCTTGGAAAA
CCTGAACAAAATGAGTGAGAACTCACACCACCGCCGTTCTCATCGTATCTGAGGTCCAGC
ATGTGGTCTGCCCCAGGATTGGTAGGCATGAGAGACAGCTTCTCTATGGTCAAAGGCACT
CTTCTCCTCTTAAGTCTCAGTTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NACAAGAAGTTTCTAATGTACCTGGGAGGAAAAAGTCCATGGATACCTGGGTTCTTGGAA
TTCTTTGGGGGCATGGGGCTTGTTTTACATCTTAGGAAAGGTCTCCAGCAGTGGACCCCT
AGCCCCAGGAGAACGTCCTCCTTCATGCTGTGCAAAGAATCTAAGCAACAGAAACAGTTT
AGAAGACTGGGCTCCTGCTCATGCTTTCTTTCCTTATTTTCTCTCCCCAGCATTGGGATA
TTGAGAGTCCCCCTGAAGCCTCTGGATCTCTTGTGTCTTGGGCTATTGTTGATTTGGGAA
TGGATTATTTTGGGGTTTTTTAAACATTTTATTTTGTTTATATTTTTTTACTTTTTGGGT
CACACCCGGCGATGCACAGGGGTTACTCCTGGCTCCTGTAATCAGGAATTAAAACTGGCA
GTGCTCCTTTGACAGTCTGGGATGATGGGAATTGAACCTGGGTCAGTCGTGTGCAAGGCA
AATGCCCTACCCACTGTACTTTCACTCCAGCCCTGGGAATTGAATGTTTTGAAGTGTTTT
TGTTCATCCCTGTCTTGTAATCCACTAGTACCTCTGTGTCCATGTCTATATCTGTTCAGG
TTTACTCCCATGGCATCCCTTAAATTTTCCTGAAAAACATGGCCAAGGAAAACCACCATT
CCAGCCCATTTGTTACTTTGAGATACTCTGAGAACACTATACCTCAGTTCCCAGAAAGAT
CCCTTAGTGCCCCCGGCACAGTTCTTGGAAACACTCCTCGCCAACATGAATGTGTGTGAA
CTACAGCATTTTGTTGGAGAGCAGAGCTAACTGCCTCCATTCCTCTTGCTTGACAGTGGC
ACCCCAGTGATTGCTTTCACATTGTAAGCAACTGCCCATAGTTTTTTGTGTGCTAGAATT
TGTTTTGGTATCTTGATTCCTGGTGCTTTTGCCTCAGCTTAAGGGAGATAGAGTATGCTG
TGCTTTCAGGGCAGCAATTGCTATGAGCCAAGTGGCTCTTGTGCATTCTGGAATTGACTT
TGAAGTTGAAAATTGGGCTTTTGCAGTGGAAGGCTGTGGTCTCCTGCAGTGAACAAGCAG
CTGGTAAAGTAGTCGCAGAAGGAGTCAGGGAAGGTGCTGGTAATTTCTAGACATACATAA
GCCCCACACACATGCACACACTGGGGCGTGCACTTATTCTAGCACCGCCTATACATTTGA
TGTCTCTCATGCCTGCCATGCTACTCTGCGGCATGATAATTTATGAAATCAAATCAAATA
CCTACCAGTCCTGTCCTGGGATCCTGTGGCTGTGGTTTCTCATGCTTGTTTTGCATCCGC
ATTCTCATCCATTTTATTTTTCTGTACATTGCTCAGGTGAAGGTTTCCTGTCAGTCTTGT
CACCTACCAAAAAGAACCTCCTATTGTTTCCTGAGTAGATGTCAAAGAGATAGCCAGGTC
ATGTTGGGCCAGAGTACTCTAGTATCCATGAACACTTCCTGACGGTAAGCTGTTTATGCA
TTCAATAGGCCATCCACTCTGTTTTTCCTTTTGTCCCTCTTGAGTGCTTGAGGATTCATC
CCCCACAGTCATGTACTACTGGCCCAGGCCAGCTGCCTCCTTTAGGCACCCTCTTGTGCA
TGGATCAATGATGAGTACCCATAACTCAATACATTCCTTGGAAAACCTGAACAAAATGAG
TGAGAACTCACACCACCGCCGTTCTCATCGTTTCTGAGGTCCATCACATAGTCTGCCAAA
GGGATGGTATGCATGAGGGACAGTTTCCCCCTTTTTCAGACTCATGCACCATCACTTAGA
ACCTCCACATTAGGGGTCCCAGGCCTTAAGACCGAGGACTTTGATTTCAGCAGGCACTGT
GAGCACAATGACTCCTAGGCACCCGGAGTTCTCTTAGAAGATGATTATTGGGCTCTGGAA
TGTGAGGCTGTGATATCCTCCTGTCCAAATGTAGGGTGGGATTGGGTGGACTTAATAGAC
TGGGTGCTGGGGAAGGTGTTATTTGTTACCCAGTCACATTAATAGAGTGACATGAGATTT
TTTTCAAAGTCCTGCTTATTCCTATATTGCCTCTCAGGCCTGCTGTCCTAGTTTATTGCT
GATTGTTTCAGAGGGCAAATATGGGCCTACCGAGAGGTATCCTTTGGTTTCAGTCTTGAA
TATCTGTTCTCTGGGCATTTTCTCATGTGTTATGCTTTTTATATACATTGCTCAGGTGGA
ATTTGCCAACCACGCTCCCATTGCACCAAAATGAGCTTCTTGTCATCACCAGTCTTGAGA
CCAGCAGGATAGTCTGGTTGAGTTGGACCATGCTGTTGTGGTTCCCGCAGTTACTTCTGG
GAGGTAAGCTGTTCATGCCTCCAATATGCCATCCCTGTTTGTCCTTTGACTGTCTTGAAG
GGTGCACGAGTACCCCTTCCTTTTAGCCATGAATTACTGTGCTAGGCCAGCTCTTTTTGT
GAGGCAGCCTCCCCACTGTGCTCGGATCGATGATGAGTACCCCTAACTCTATGCATTCCT
TGGAAAACCTGAACAAAATGAGTGAGAACCTCCACCACCGCCGTTCTCATCGTCTCTGAG
GTCCAGCACATTTCTGCCACAGGGACAGTAGACCTGAGGGACAACTTCCCCCTTGGTCAT
TTGGTCATTTGCATGTATTGCATGTGTTGTCACCTCTAGTCTCCACATAATAGGCAAAGT
GACATCCACATCTATGGCTTTTGTTTCACAGGTGGGGCCGTTTGTTGTCACTCCTTTTTA
GACAGTGGTGTGGCATCTTATCCTTGGAGACACAGAGTCTTTCTTTCCTTATGCTGTGAT
TAGTGTTTCCTGCAGTTGAGGGTTGAGGAGATGGGACTGGAAGTAGGAGACCTGGTGAGT
GTTTATTTTGAAGCATGTGCCATGTCCCTACCTAGTTGACTGTTGTCACTGCCTAGTCAT
TGTGTCATTGAATACTCGTGTGAACCTATCATGTGGTTTTAAGAGGTACCTTAGCATTTT
TCTCTAAGCAGGCCCTAGATGACTTGCTGCACTTGGTTGGCAGGGGCACACATGGGTACA
GTTGGTGCATCCTGGAGTTGAAAGATTTTGCTTTATCACGTTGCAATTTCTTTTTTTTTT
TGGTCACACCCAGCGATGCTCAGGGGTTACTCCTGGCTTTGCACTCAGGAATTACTCCTG
GCGGTGCTTGGGGGACCATATGGGATGCCGGGGATCGAACCCGGGTTGGCCGCGTGCAAG
GCAAACTCCCTACCCGCTGTGCTATCGCTCCGGCCCAACGTTGCAATTTCTTGATGGGCT
GCTATTGATATCAGAGGAGGAGGGATCTCTTGAATGATCCCTGGCCACATAGATCTCCCT
CCTTGTGGCATGCAAAGAATCTAGGCCATATAACAATTTTGAGGTCTGGTCCTCACACAC
TTTTGTTGGCCCCTGTATGTAGGATATATATTCCTGGAGCCTGCTTGCTTTGGGGAATCT
TGCCCTGAGAATTGAAGCTGTCCAACAGAATGTTAGCTCATCCTGATGGACATACTCCCC
TTAGTTCCTTTGTATGTTCTTGCATGTGTCTGTTGAGGTTCATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved