Sorex_araneus Locus Mono:311:SNORD42
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:311:SNORD42
Sorex_araneus
Mono:311:SNORD42
scaffold_189019
SNORD42
1001..1068
2068
AGTATATGAATGCTGCTTTGTTTAGTTGTTTATTAATTTTTATGGTTTTGTCTGCATGA
AGTTATATGGTATTTGTATTTCTATATAAATTACACTACTTATTAATTAAAGACATCTCT
TCATCAGATGATACCATTAAGAAAAAGAAAAATGGCAGACCAAGGAAATATATTCACAAA
TCATATCACCAATAATTCATTATATTTAAAAATATTATTTAAAAACTACCTATATCAATA
AGAAAATGAGAGAAATACCAATGTAAAAAATAGAAAAAGTGGGGCTGGAGTGATAGCACA
GTGGGTAGGGCGTTTGCCTTGCATGCGGCCGACCCGGGTTCGATTCCCAGCATCCCATAT
GGTCCCCCGAGCACCGCCAGGAGTAATTCCTGAGTGCATGAGCCAGGAGTGACCCCTGTG
CATCTCCGGGTGTGACCCAAAAACCAAAAGAAAAATAGAAAAAGGACAGCTAGCACTTTA
AAAATGTTGCCAGTGAATGTACATACAACTTTGTAGCCCTTAACAGGCTCTCCAGTGATT
CCCCCAGAGTAGCGAGCTGGGTGGACAGTGTTTGGGTTAGCTAGCCCTCGGTGTCAACTC
CTGGGCAGCTTTTTGAAAGTTGGCCTGGCCTCGCCATGGTGCACACGCCTAGGTGCATGG
ACCAGGTTGAGCGGGGGGGAGGGTACGGAGGCATCTCTTAGAGGTGTTGTGCCCCCAAAC
TAGAGCATCGTGTTTTCACACCAATAAGGAGTCAGTACCATCCATGTTGTTTTTCTACTT
TTTAATGTTAGGCGAGTGTATTTACTCTCTCCGTATTGTGCAAATAATGGGGGAAATATT
TTTGCTTCTTTGTTTGTTTTTTGGATCACACCTGGCGATGCTCAGGGGTTGCTCCTGGCT
CTGCACTCAGGATTCACTCCTGGCGGTTCTCAAGGGACCATATGGAGATCGAACCCGGCT
CAGCCGTGTGCAAAACAAATGCCCTTCCCGCTTTACTATGGCTCCAGCAGCCTGAAAAAT
ATTAATTTCCTGAGACTTGAGATGTATTCAAAGGTACCACTGGCTGGAGGTGCCCAGTGA
TAGATTTCTCTCCGCCCTGTAATATTACTTTCCTTTCTTCCTCAGCCCCTGTGCCCCTCC
CAAAGCTGAAGGCAAAAAAGCCAAAACTTTGAAGGCCAGAGGTCAGTACTGAAAGATGTC
CACAGCCAGAAAAAGAAGATCCACACCTGTCAACCACCTTCTGAAGACCCAAAACACCGA
AGCTGAGAAGTCAGCCCAAATATCTGCGAACCTCACCACCACTCACCCCTGCTCCCTGAC
CCAGAGAAACAAGCTTGACCATTTCATCCTCATCAAGTTCCCTCTGACCACGGAGTCAGC
TGCGAAGAAGATAGTAGACAACGCACTTGTCTTCATTGCGGAGGTCAAGGCCAACAAAGC
TTCAGCATAAACAGGCCGTGAAGAGGGCGTATGACCTTGATGTGGCCAAGGATGACACCC
TGATTAGACCTGACGGAGAGGAGAAGGCGAATGTTCGGCAGGCTCCTGACTGCTGCCTTG
CAACAACAAATTTGGGATCATCTAAGCAGTCCAGCTGGCTAATCCTAGATATAATTTTTC
ACCCTCAAAATAAACTTTGTAGCAGAAAAAGCCATTAGAGGAATATCTAATTAAAACCAC
ATAAAGTATTATACAAGCCCATTTGAATGGTTAGCATTTAAAAATCAACAATACCGAGTA
TGAGCAAATATAAGAGGCAGTTAAGAACTATTATTATCTTGGGGCTGGAGCAATTGCACA
GCAGGTAGGGTGTTTGCCTTGCACGCTGCTGACCTGGGTTCGATTCCCAGCATCCCATAT
GGTCCCCTGAGTACCACCAAAAGTAATTCCTGAGTGCAGAGCCAGGAGTAACCTCTGTGC
ATCGCCAAGTGTGACCCCAAAATGCAAAACCAAAACCTATTATTATCTTTTATTTATTGG
TGGGTACTCCTTAGTAGTGCTCAGGGTCACTTCTGGCTATACTCAGCTGACTGGCCGGGT
AGTTCAATGTTAGGGCCTGGGAATGACTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved