Sorex_araneus Locus Mono:18:SNORD93
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:18:SNORD93
Sorex_araneus
Mono:18:SNORD93
scaffold_261886
SNORD93
1001..1072
2072
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCCAAGAGACAGGAATTGCAATGGGCAATT
AATGTGTACAACTGCTGAATCAGGGAGCGGGAGGTCTGGGTTCCCTGCAGGAATGACGAC
TGAGCCGCAGAGCCAGGAGTAAGCCCCAGCACCCGGTATGTCCCCCACCCCCACCACTCG
AAAAAGGTTGAGCTAAACTCTTCAGGCAAATCCATTTGGGTCCAGCCCATTCAAGCAGGC
TGCCAGCAGCGTGCGCCAGTGTCTATTTAAGGGTAGGGTAGCGTGGAGGAGCAGGGCTGA
GGACGGTTCTTTCCTGGCAGCGCTCTTGCCTGCTCGCAGTAAACAAGTTTCCTTTGGTTT
TCTAATCAGTTACGTCTGTTTTGGCGTTTCCGATGGTTGCTACTGTGGCCCGTTTAATTT
TTTTTTAAAATCTGTACTATTAATGTAACAAAGTTGGAAAGATGGCGACTGGAGAACATA
AGTTTTTTTAACGGGAATTTTATTCCAAAGGCTTATAGCTGTCAAAGGTAGCCAATAGGG
TTCCAAGATAAACACAAAGCAAAAGAAAATTCATAAGTTATTTCACAATGTTAACAATAT
TCTTTTCCACCAGGCTCAAGAGATCAAGATTCTGATGGACTTAGGTAAGAACCAAATGGG
TAGAATTTGGCTTGAATTACTAACTAATCCAGTGGGATTCTTGGCCAAGGATGAGAACTC
AATCTGATGGATGTACTTCCACTCTGATGGGTTAAAGGATTTACCTGAGGCCAACTTGAC
AGACAGCACATTATAACCTGCAGTGACCTGTTGGTTTCCCTCTCCCCTTCCCCTCCCCCG
CCCCACTCCGCGCCTCCCCCCCACCCCCAAGTATGTTTTGGATAAAGAAAATCTTGGAGT
AAACAGTCATTTTAGGGAAGATGGGTTCCCATCCTAACTTGCCAGGAACCCCAGGTCCAT
CTCCTGGGCCCTTTGGTGGATTAAAGTTTTAGCAACAAAAGTGTAAAATATTTGAATGGA
TGTTTGAATCAGCTCAAACAAAGGTCTGGTACATTGCACTGCTGGGTATTACCCAAAACT
TCACACCCCCAAATGTTTTATGGAGGCCAGAGATTTGGCTCAGTTTTGCAGCTGAGTGTT
TGCCTAGGGGTGTGAGAAGCCCCGAGTTCAATCCCCTAGACCTACATGTGCACAAAACTG
TTACCCAGAGCCTTACTGAGTTTGTATGTAGTATGCTGGTGGTCCCTTCTACTTACCATA
GATCTTGTGAACAGGTATCTTAGAAAGCTAAGAAATATGTCCTGATAGGATGTCTTATTT
AACAGCTGCCAATCTAATTGCCCACTGTAATACTTCTTTTACAGATCTGGGGCTTGAAAT
GAAGAAATGTATTTAAAAGAAGCTTTTCAAGTAGTGGGTGATTTGACCATGTGATGACTG
ACATATGCAGAAGACAGTTTTTGCTCCTTTTTTCTTCATGGTGGGGAGGTATCTGATTTC
TAGCAGGTGAGGGGACTGAGAGATGGACAGCAGGTAGGGAACTTGCCCTGCACGTGGCTG
ACCTGAATTTCAATCCCTGGCATCCCTTCAGTCCTGAGCACTGCTGGGTGTGATCCAAAA
GCAAACTTTTAAGCAAGTGCCAGATGTTTAAGATAAAACTCTATCTCCCTCATAATGAAT
TTCTATTGATTTTAAATTCTTTAAAACAGTCTTTTTATGGAACTGGTGTTATCCTGAAGC
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved