Sorex_araneus Locus Poly:8:SNORD113
snOPY snoRNA Orthological Gene Database
Sorex_araneus Poly:8:SNORD113
Sorex_araneus
Poly:8:SNORD113
scaffold_204426
SNORD113, SNORD113
1001..1075, 4398..4471
5471
TTAACAAACGAACCAAAGATTAACATATGCTTACTATAATACTTAGGAAGATGAAGAGG
GTGAATTATGAAGTTTCACTAATCATGTCCAATTATGATAAAAGGAAGTAAGGCAAGGGA
AAATATTAATATAGAACCGTGGGAGTATTAAGCCTTTACGAAATAAACTCTTCAAGGACA
TTTCCTCTCACTCAAAAGATTATAGACATTAAGGGCTCATATTTGTGTTTTGTGTTAGTG
GGAAGGTTTATGTTGCTTGTTTCCTTAAAAGATAAAAATGCTGGAGCTGGAGAGATAATA
CAGCAGACTGTAAAATTGCCTTGTGGGCGACTGACCTAGGTTCCACATAGGTCCCTAACC
CTTCTGCGAGTGATCCCTGAGCAGAGCCAGAACTAAGCCCTGGACGGTCAGTGTGTGTGA
CCCACAAACAAGACCAAAAAACCCCACATATAGAAAACAAAAATGCATATTATGCTAAAG
GAATACATAATGTATGCTACATTATGTATCATTATATAATGCATATAATGAAATAATATT
ATATTATTTGAATAATGAAATGAAGATGCCTAGATCAATAGAAATAACCTGAGTCATGTT
AACTGTTCTGAATTCTGCTTTTTAGGAAGGACTTGTCAAAGCTGAATTCAGCATTTCACT
TTGGTCACAGTCTCTGGATTTGTAGCTGCGTGGAAACCTATGTGAGTGAAAGACAATCTA
TTCCTCTTACTTTGGGTGTTTTTCTTAGAGAAAATTTTCTTAGAGAATATTTTTCTTTTT
CATATTTAAAAAATTTAAACATAAGGATACCAGAAATCAATGATTTAGTTTGTCGTAATG
AGGTGATTAATGAAATATATATATATTAAGTTATCAATGCTTCCAAAGAAGTGATAGCTT
TTGAATGCTCTTGCCTTTGAGTTCTGTGCTTCTCAGGTACATGTTAGGTTATTAATAGTG
GATGGATGCATTCATAAGGAGGAAGGCAGAGACCCCAGTGATGGACCAGTGATGACAATT
GATGGCGCCAGAGTCCTAGACGATGAACACTGTGTGTCTGGAAGTCTGAGGTCCAAAAGC
AACACTGTTTAGTCTACTGCTTCTCTGTCAGCCCTCAAACGGATTGATCATTACTACAAT
GAATGATTTTGTACTGGTAACTTTGGAGCCAAAGATTTCAGTATTATTGGTACAAATGTA
TTCCTAAGAGGTCCATCAGTAAGTGAGCCCTAGAAGAGGGGAGGAAGGCTTATCAACGAG
GCATATGTGATGAGGCACGTAATATCATTTGTACAGACGAATGAAGCTGATGATTTTAAG
CAATGTCGAGGTATTAATTCTTTCCTATAAAGACCTTATCTTTATATAACAAATCATCAG
TGCCTGTCTGCTGGAGTGGATCATATGAGAAGGAGAAGCAGGCTTTTAGAGATAGTCCAC
ATTTTAAAATTCTCTGCTCTGCTCTGCATTTCCTGGAGACCCCGTAGCAGGCCTAAGCAC
CTTCCGTGGTGAATCAGTCTGGTATTCCTTCTGATTACTCAGCGTAGAAGTCATCGTGAG
TAATAAGTAAAGTTTATCTTTGTTTGGGAGACTTTTCAAAAAATGACAAAAAAGTGAATA
TTAGGAGGGTGATAGAAAGTGTCGCGTTCAGGGTCAGGGGAATGAGGCCCATTATTGTCA
CTGTTTTTGGCATATTGAATATGCCTTATTAACTTTCAGATTCATCATTGATAATATTGA
AAGAGAGATATTAATGCGCAAATAACACAAGTCGATGCAGAATATTTCTTGCTTTTAGTT
TTGGGTGTTTTTAGAAAGGTTTAAAGCATGAATATTTATGATTAGTGAATTAATCACTGT
ACCTTATGCAAATAAGAATGAAGCAGAAGGGCCAGAAATAGAGTTCAGTGGTAAGAGCAC
TTCCTTTGCATGTGTGAAGCCCTGAGTTTGATCCCTGGCACCTCAAATAAAATGAGATTC
ATATAAGAACCAACAATAGTAACAATGGTGAAGTATAAATCATGATCATTAAATAATATA
TTCCCATAGCTCTGATATCCAAAAGAAAAAGAAATATAATCTATTGCCTCTATTTGACAT
GATAGTATAGATATGTTAGTGAAAGGGAAGGAGAATTTTCTTTTTTTTTTTTTTTTTTGC
TTTTTGGGTCACACCCGGCGATGCACAGGGGTCATTCCTGGCTCATGCACTCAGGAATCA
CCCCTGGCGGTGCTCAGGGGACCATATGGGATGCTGGGAATCGAACCCGGGTCGGCCGAG
TGCAAGGCAAACACCCTATCCGCTGTACTATCGCTCCAGCCCCCAGGAAGGAGAATTTTC
TTGATGTGTGTTAAAGAATGGGTAAAAAAATGATCTCCCCAAAAGAATTAGTGTATAGAG
TTATAACAATTAAGGTAACTAGAATGAAGTGTGTCTGTTTTATCTTACGTGGTCACTGTC
ACTATCACTGTCATCCCGTTGCTCATCGATTTGCTCGAGTGGGCACCAGTAACGTCTCCA
TTGTGAGACTTGTTGTTACTGTTTTTGGCATATCAAATATGCCACGGGTAGCTTGCCAGG
CTCTGTCGTGCGGGCGAGATACTCTTGGTAGCTTGCCGGGCTCTCTGAGAGGGATGGAGG
AATCAAACTTGGGTCGGCCACATGCAAGGCAAATGCCCTACCCGCTGTGCAATCGCTCCA
GTCCTATCTTATGTGGTAAGAAATAAAACTCTAAATGTATATTGGAAAAGCTGAAGTTCA
TTAAGAAAGCAACATTTTCTTATCTCTTTGACTAAAACTGATTAAACAATAAATAATGAA
GTTCTTATGTTAGGATTATCTTTGATATTTGTTTTTCTAAGAGAAAATAATAACAAATGA
AGCCAATGTTTGCTGAATTCTAAAATGACTGATAAGTGAAGGCATCCTCTGTGGATAAAT
AGAGAATATTTCAATTGTGTTATTATCTGTTCTGCTCTCTGTCACAGGACAGATAGCCTG
ACCTTACGGAAGCATTTTACCATGATGAGCTGCTCAATTGATGTCCCTTACATAAAACTA
AAGACACGGTGAGTGAAAGGGTCTCCCATTATCTTGTTTATTTATGTAGGCTATTCGGTG
TTAAAATGAACAATTATTAAATATATTCAGAGAGTGTCCAACAAAACTCAATAACAAATC
TGGACAAAATATTTTGATTAGTTGATATTTTGCCACAAGAAGAAAGATTAATGGAAAAAG
CATTGTCCAGTGGAGCAGATGTTCTGAGACAGATGTTAGGATACTGGATGGTCTTATCCC
TGATTTTATTGTTACATGAAGGCTTATTTCATGATTATTAATGAGTTAATTCATTGATTG
GTTCCAAGTCCTGTTGAGAGTGAGGAAGACGGAGCCCAGCTCTGGCTTGGCGAGGAAGGG
ACGACTGTCTGTCCACACTGTGGCTCTGTCTACATCTGAGCCTATTTTTCTGTCATTGAT
GTACCACGGGCATATTTCAGAATGGTGTAAGGACTCACTTCCCTGGCTCTGTGCCTATAA
AATTAGAATAATTTTATTTTGAGGCTATCAACAGCAGAATAAATATACGTCCAAATGAAC
GAAGTTGAAAGGATTTAAGTCCTGCTTACTAAATGTAGAGTGATTAGAATGTTGCAAATG
CATGCAGAGTGGATCAAATGTATTTTTACACTTTACGCTGAGACAGTGGTAACCGTGGAG
TCTCTGTCTGAGTCAGTATATGTATCTTAATAAGAGAGAAATATCTACATAACACCATAA
ATGAACAGTCACTTTATGCCTTTGTCTTGAGTGTTGGAAGCTCGGGACCAATAAAGAGAA
ATAGTTTTCAAGTGTCTATTTTAGGCTGAGAGACACAGGGAGTACTCAGTGGCCGTTAGG
TATCAGCCTGTTCCCATCTTTGCCTCTCTCCCCGCTCCCTTCCTCCTTCTCTCTCAGTTT
ACCCTTAGGAGAGTGGCACTCTTGGGCAGAAGTCTCAGCCGTCTTGGCCCGCTGTTCATA
GTTGCGACCCTCTTTTCTGGTGCTCAGACTAAGGCAAGTACTGCTGACCATTAGGGCCTG
GTGTTAGGAGTTTTGTAGGGCAACAGGGATTGATTCACAAATGCTCCATGATCAGTGAGA
CCCCTGTGTCCCCCTGACGTCTGCAGGGTGGACCCGGCTGATTGAGTGTCCCGGGTACAC
CTGGGTCCAGGGGTCGCCTGGAATCCCTGGTGAGGAAGAAGTGGAGGGGGCGGTGACCCA
GGACTCTTCATCTGACAGGTGGGGCCACTTCTGGGGTGTGTCCAGCAGTCATTCCATAGC
CCCAGATGCGTCCTGGCCAGCCCACAGGCTGACGGTCACATGGACGATGGGGTCGGTGCA
GGGCAGGGCGGACAGGATTGGATCGATGATGTTCGCTGTTGGCGGTGGCGTATGAGTCTT
CTACGATGAATACGTGTGAATCTGAGGTCCAAACACATGATGTCCAGTGTCTCTGCCTCT
GCCTCTCGGAACAGGTTCTGGAGTGGTCAGTGAGCGAAGGGACCAATGCTAATGGAAATG
GCGACAAACCCTTTTGTGTAACCCCGAGACAGTGTATGGACAGACTTCCCTCTAGTCCCC
ACAGCCATCAGTGTGTCAGTGGCTTCCCTCCCTCCTTGTCAGGGAAGTGTTGGAGCCGGG
GCCGTGTTCCCACGGTGACACTGGTGAGACCCTTAGGTCTGTTTTCTCAGGAGAAATAAA
CACATTCTTTTCAAACGGACAGTCCCGAGGGCCGTCCCGTATAGCCTGCTAACATGACCT
CTTGGAGTTATCTCCAACGTTTGGCATCCCGTCTCTCCCCCACCCCTCTTTCTGTCTCTC
TCTCTCTCTCTCTGTCTCTGCATCTCTCTGTCTCTGTCACTCTGTCTCTTTCTGTCTATT
TCTCTCTGTCTTTCCTCTCCTCTCCTCTCCTCTCCTCTCCTCTCCTTGTCTCTGTCTCTC
TGTCTCTGTCTCTCTGTTTCTGTCTGTCTCCGTCTCCGTCTCTGTCTCTGTCTCTCCTCT
CCTCTCCTGTTCTTCTCAGAACTGAATCTCTCAGGAAGATAATAGTAATGGGCCTTTGAG
TTGAGAACCTTCTTGGTGACCAGCCCCGCGAATGTGACCGTCTGAGGACCTGAGACCAAG
GCAAGTATGGGTCAAGCTTTGGGTCCTGCATGTTGCTGTTGTTTCTCAGACTTGTTGTTT
CTCAGACTTTCAGAGTCCCTGAAAGGTGTGAACTGCAACTGCTTTACGTTGGGTTGAGAA
ATCCTTATTTTAAGCGAGTCCATTGGGCTAGGGGTGACTCATGGGGCTGCGTCCAGTTTC
CTCTGGGGGAGTCCTCTTGGATATGCCCCGACCACAACAACAAATAAACGTGTAAATGGC
TCTGAAAGTGACCGCTCATGATCTGAAGCACCGTTTTCCTTTTCCACGTGATTGGCATGC
AAAGACCGGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved