Sorex_araneus Locus Mono:694:SNORA38
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:694:SNORA38
Sorex_araneus
Mono:694:SNORA38
GeneScaffold_3011
SNORA38
1001..1131
2131
TTTTTTTTGAAGGAACACCACTATTTTCCATAGATACAGCTGTTCCACTTCTTGGAATT
TACCCAAAGTATGTGAAAGCAGTAATCTGAAAAAGATAGATCCCACCCCTAGGTTCACTG
TAGCACTATTCACAATAGCTAAGAACTGGAAAAGACCGAAATGCACACATGAATGAATGA
TAAGATAAAGACTTAGTACAGATAAACAATGAAGTAGTATCCAAGTATAAAATACATGGA
ATCTCATGATTTTTATCTTTCTGAGGCTGTTTTTCTACCTATAATTCAAATTCTTCATTT
AACTCTGGAAAAATGAAGGTATCATATTTCAAAGAAGGATGTCAAAGTTCATCAGATCAG
ACAGTCATAAAAATCACTTTGGGGGCAGTCGAGAAACCATGGCCAGTGATGCTCGGGGCC
TATTCTTCAGTCTGCAGTCAGGGGTGACATGAAGACCATAGGTGGTGTTAGGGATCTAAC
TGGGCAAGTGGAGTAAACTTAAATGTAAGGTAAATGTTTTATCTCACATACTATTTCTCT
GACCCACAAGTGGCATGTTTTATAGCCAATCTAGTCTTTCTTCACGGCCCTGTCTAGGAA
CCCTTGAGGGAGAGGTTCAATTATGGGCTTAAAAATTTCACAGAGTTTTGCAAAATTTTG
ACAAGCCCCACCCTTCCTGGAGATTGGTGATATAGACACCAGGGAGGAGACTAGATGAAA
CCAGTCTGTCAGCCATCTTGACATCCTAAAGAATCTTTGGCTTCATTTCAGTGCTAAGCT
CTCCTCCCTGGGGGAGAGACATAAGATGCTAATGAGACATGAAATGAGGCCTGTAGCCAC
CACTCCTTTATTCCTGCCGCACAGGGACATAGCTATTTTATCAGTGCTAACTCATCCTTT
CCATTAGTTGGCCATTAAATAATTTGTTTCTGGTCTACATTTCATAGTTACGTGTGGTTT
CAGACATAGTTTGATGTGCTGGGCAAATAACCAAATTCTAATCCTCCTACAAAGGCATAA
CTATGGTTCCTTATCTTGGGAGATATAAGAATTGGAAGTAAAGAAATGTGGAGTTAGAGA
AATTGGGGACTAGATTGTTCCCTGATGGCCCACGATCAACAATCCCACATTGAGAGAATA
AAAAAAACCCAAAAATTCAAAGGGAGCCTCCAATAACATTATTACTCTTGGCAGGGGGCA
TTTGTGGTCCCCTGTTTACTGCCAGGAATGACCCCTAAGCATTTAGCCAGGAGTAGCCCC
TAAGCACCACCTGGGTGTGGCTCAAACCCCTCCCCTGCCCCTTCTTTACAGCAGCTCTCT
TGATTTCAAAGAAACAGTTTTTTTACTGTACCACATCAAAGAAACAAGTAAACAATTGAT
TTTTAAGCATCTAGAAACATATCTTTTGCTGGAACCAGGCAAATCAGTACCATACAACCC
TTAATATGCTATTCTGCTCCTAACTAACCTTTAGTTAAAGTCTAGTTTATTACAGAATAG
GAAACAGGCTATTAGCTACTGAGTAAAGCTATTGGTTCTCAGTGTGCGGGCATTAGCTAC
TGACTAATGTCTAGGCAATGCTACTGAATAAAAGCTAGGTTCTCAACACTTAACGTTGTT
CCAAATCATTGCTTTAGGGCATGGGGTGGCAAAGAAGGTGACCAAAACAATTTCAATTAA
TTTTGATCCTTTTAAGCTAACAAATCAAAGGAACACAGCTGTATGTGGTATAGCATGATG
CCTTTCTTTCTGCCTTGCAGCCCAAATATTTCTGCCGGCAATACAATATGTCCGGAATAT
CACCATTACTAGGTTATTGAAAACTGATTTCAAGCAAAACGACCCATAAAAAACTATGTC
CTCAAATTTAAGTTTTATTCCAACTCGGCTGGGATTATTTTTCTCCTCATCGAATTTATA
AGCAAACTATGTGGAGTTAAACAATATTATTCAATGGCTTGCTAGACTCCATGAGGGCAT
CGGTTACAGATTTGATGTGGCAACAAAAAATATGTATCTTGCAAATGGAGTCCTCAGAAA
GCAAAGAGAGTTACTGTGAACCAGAAGCAACATTGTTCAAAAGATCACAGATGCAGAATC
TGCGGCAGACATATCAACTGATAAATCATTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved