Sorex_araneus Locus Mono:776:SNORA57
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:776:SNORA57
Sorex_araneus
Mono:776:SNORA57
GeneScaffold_4148
SNORA57
1001..1149
1596
AAAGTTTATTTTCCATTGCTCATTTAGAATACCATGAGAGCTTGCGAGTGCAAAGCCAG
GAGTAACCCTTGAGCATCGCTGAGTGTGACCCCAAAAGCCAAAAAAAAAAAAGAAAGAAT
AGTCAATGAAAAGGGCAGCATTCCCAGGATTTGAGAGACCTTGAAACTTGGACGCAAAAA
TGCCATGCGTGCCCTAGGAAAGATCCACCCGGCTGTGCGCACACGGTCACGCGTGCTTGC
GGCTGGATAAGAACCCATGCGAGTGTATGAACATCTGGCGACTCCTGGGCATGTGACGGG
AGCCAACGGCCCACCTGGGGACCCCCGGGGGCGGGGGGGTCCGAGGCCCCAGGGACAGAC
TCTAAGATTTTGGAAAGCAAGCACAGCGGTCGCGCAAGCCGGCGGCTCGGGAGCAGGGAC
GGGGAGGCAGACCCGGGCCCGGGCAGGGGCCTGAGCACTCACGCGCGCTTCTTGAGGTGG
TGCCGCGTGATGAGCCCCTCGTCGACCACCGCCCCGACCACCCGGTGCTTGAGGCGCCGC
TCGCGGGTCAGCATCCGCCGTCGCTTGAACAGCTTCTTCTTCAGCTCCTGCAGCAGGGGA
GGAAGATGCCAATCAGACCGAGCCCGGGCTCCGGGAGGGGCCCGCGCCCACCCACGCCAT
CGGGGTGAGGCCGGCAGGCTCCGAAGCCCCGGTTAGACACCCAGGCGGGGGGGATCCCAC
CCAGTCACCGTGCGCGGCCGGTTGATCTTCCCTCCCGGGCACCCCATGGCTGCGCGGCCA
CAGCCAACTCCAGGACCGGCGTTTCCGCTCTGCGCTGGGCCCGGCCCCGCCCCCCAGTCC
GCCACGAACCAATCGCAGCCATGGGGCGTGGCCTAGCGCTATATAAAGGCGCGACCGGCG
CTTGCGGGTCTTTCGGGACCTGCTACCTGGTAATCATGCACGTTGCTTGCTTTGCTCGCG
CTGCAGGGGAATTCGCGGGGAATTTGGGGCGGGGGTTGGACCCTCCTTTTCTTGGCGGGT
ATCGGGCGTGCGGTCCCGATGCCCGTAATGTTCGGAGGCAGAGGGCAAGGGCGCCTCGCC
CCTCGGCGTCATGTCTTCGGTGCCGGCGGCTTCCCATCCGCCGGTTCTATCCTCAAGCGC
CGGGACACGCTACTGCAGCGGGGCGGACGGGACGGGCTCGGCGGGCACCTCCTCCTCGGG
TCCCCTAAACACGCTCCTCTTACCATTTCAGGCCCCAGGAGCCGGAGCTGTCGCGTCCCC
CTCCCCCCACCAACCCCCGCGCCTCGCCGAGCGTGGCAGCCATAAAGACCGTGTTGTGTA
CCGGGTCAGTGTGTCCGGGTCTGTGTCCGCGGCTGTCCCGACTGGTCTGCGCGCTGAGCC
GGATCGTAAAGCGGCCGCGGGTCTCGTGGCACTGCAGAGCTCTCGTGGCTCGGATGGCAG
CGTGCGCCAGTGCTCGAGGGCACGCGACGGCGGGGCCCTCTGCAGTCGGTACCCCGGGGT
GGCGAGGGAGTAGGGTCTCGAGCTTGGAGTTGGCTGCTGATGTCGTAAATCTCCCGGGCC
TGGCCATTGCGCTGCGCTCTCCTGAACCCTCTGGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved