Sorex_araneus Locus Mono:702:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:702:SNORA58
Sorex_araneus
Mono:702:SNORA58
GeneScaffold_4258
SNORA58
1001..1131
2131
ACCCAAAATGGCTGCTGTGCCTTTGGCCAGACCTTAAAAACTTGGAGTCAAGTTTACCA
AGAAATTAAATGGCCTAAAGTTAGGTATGTGGGAGATACACCCACAAACCACCTCTGGCT
AAGCTATATATGCTCATTTATTGCCTTATTTCACAGACCCATAAATCTCAAAAGAGATCA
AAAGACGCAATTAGGGCCTAAAATGTGGAGGTAGGCGGGAACCCGTAACTGAGAGCTCGA
GGCCCACTTGGATCAGGACTGGACCTCCTCCCCCAGGTCCCCAGTTTTCCAGTAGCTTGG
CAGTCACACCCACAACTGCCCCCAGCGCCATGTAATCTCATCAACGGCCAAGACCCAGGG
ACTATAAAACTCCTGAAAGAGAGCATTGCAGAATGTCCTGACCCTGCACCAGGTTGCCTT
CACCAGGATGCCCCAGAAGGGAGCAGGTGAGAACCCTCCCCGGCCCAAGGGACCCAGCTC
CGGCAGCCAAAAACATCCACAATCCAACCACTGCCATGCTCAAGGCCACTCCCCATGCTC
AGGCTGAGTCTCATGCATGAGTAAACATATTTCTAGACCAAAAGTAGCCGTGTGACACAT
CATAAAACACTCCCTACCCATTCTCCATAATCACTACACCAGAACTGATGGGGTTCAGAT
AATAAGCAAAGGGAAATGTATATATGTATATATGCATATATGATATATACATATTTTCAG
ATATATAATCCGAAGCTCACATCACCCGTACTTTAACAACATGTTAGTATCCTATAGAAT
GTCTTAATGACTCCTGCCAAAATAGAACAATTGTCACACTCTTTCCTATGTGAATACTTT
TATGTAAGCATGTTCAGCAGTTCTTCATAACAAACAATATGAAATATATTATTTCGGTTG
TGTTTTGGGACAAGGATTGGAGTTTGGTATGGAAACATCCTGAATTTGGTGGTGGGAAGG
TGTAATGGTGCTGGTGCTGGGATTCGTGTTTAAATATTGAATGTAATCAAACATTGTGAA
CTAGCTTATAAATTAAGAATTTTAAAAAAAGGAAAAAAATAGTAATGTGGAGTTAATGCC
CAATTAAATCAGCTTAATCAATGGCTGAATAAATAGCAGTGCTCCTACTTTATAAAAAAA
AATATGTGTATATATTTCCATCCATTGTCTTTTCACTAAATCATATTGAGGAGGAAGGGC
ACCTCCCAACAGTGCTTAGGGGGCCTTGCAACGGTCCCACTGGCAACACCCTGGTTTTTA
AGAGTCCTGAGCACCACAGGCATTTTACCAACAGAATCAGTGGTCAATCCACCAGCACAG
TCATGGTGGGCCAAGCAGTAGGGCACGAGCTCTCGTGGGCCTTGAAGTAGGCAGACAGGC
AGATAGGGAAGGCTCCCTCCCAAGGCAATGTCAAAAGCCGACCTTGCAGAAAACAGGTGT
GGGGGAGGAAGGGACAGGAACTAAGGCCTGATAAAACTCTCACCAATCTACAGCAACAGA
CCCAGAGAAGCTCCTGAAGAAACAAAATGCCAGGAAAGGAATTTCAAAAAAGACCATCAC
CACTCCCAAAAGGGGCAGGTTGGAGAAACCCTCGAAAAGCCACCTTGAACAAAGGAAGGG
CGTGCATATGCTGCCTGAACCTATGTGCAGCCTATGCCCACGTGGCCAAGCGCATGTGGT
GCCTGAGCACATATGTTGCCCGCATCTCCCCTCTTGATATGTTTACTTTCATGCTTTCAT
GTCCAATGCTGGGATGTATATAGGGGCTCTCCCCCGCCCTTGGAGAAGCCCATGTTCTCT
CTTAAGCACGCTCTCCCACTTTCTCTTCCTTCTTCCCTTCAAAACCTTTTACTGCTTGTC
TACTCCTGAAATTCTTTCTGTGAGGTGAGAAAAGAACCTAGTATCCCTGGGTATCCAGAT
GGGGAGAAAGTGACTGTCTTTCTCCTCCCGCTTCACATACATCACCAGTGAGACCCACTG
ACATGACACACACACACTACCCCAATATATGGCTTTCTACACACACACCACCAGCAACAT
TTTCAAGGATTTCAAAATTGATCAAGTTGCATCTCTTCAATACGCGCAGTTTATATGTCA
CTAATACTGCTATTTAAAAACAGACTAAGTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved