Sorex_araneus Locus Mono:54:SNORA58
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:54:SNORA58
Sorex_araneus
Mono:54:SNORA58
scaffold_238921
SNORA58
1001..1115
2115
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCCACTTAAAAAAGGTGGTATTGACTCCGCCCAGATAAGATCCAGA
GCTGCCTCGAGCAAAACAGACCCTCTGCTCCTTAAAGACTATGATCTGAGAGGTCGTCTA
ACACATTTTGGCACCCAGAGTGGCTTCTTACAGAAATGCATCTAGACAGTGAACTGAGCT
GAAATATCAGAAATCCAAAACCGCGTGGCTGCTGTCGCGGCCACGGGAGCTCATAGAGTC
TACATTCTCAGCAATGGAAAACAAATTATTAAATGATGCCTTTTCAGCAGGCTTGATTGT
TGGGGGATAATTCCAAATAATATTGTGAGTTCTCTATTGAAATATTGAATGTATTCAAAG
TATAGAGAGACTAAAGTGAAGATCATTTGCCACTCAGGTGTGTGTGTGGGGGTCGGACAG
GGGTATATTGGGGTTCTTGGTGGCGGAACACGTGCACTGGTGAAGGGATGGGGGTTTAAT
CATTATGACTGAGACTTAAACCTGAAAGCTTTGTATTTTTTTTTCACGGTGATTCAATAA
AATTTTAAAAAAGAACAACAACAAGCAACAACAACAAAAAGTTGGTACTTAAGCTATGCT
GAATAATACCTACTTTCTCTGGCAGTAGTGGGGAGAGCCCCACAGTGGAGGGATACATTT
GGAATCGTTGACTGAAACCTAATCATGAACAGCTTTGTAATAGTCTATCTCATGGACAGT
CAATAAGAATATAATAAAATATAAAATAATGTGGAGTTCATGCTAGCTTCCGTCAGCTTA
ATCAGTGGTTGAATAAATAGCAGTACTCCTACATTTAAAAAAAGACTATAGAGGAGTTCA
AAAGAGTAATTTTAGTTTGGCCTTTGGCTTTCCGAGTAACACTTCACATAGTTGAGTTAT
CCATGATAGTTTTATTTAGGTGCCTTTTCATTGACTGGTTAGCATAGCATTTTAGGCTTT
ACCTACCTGACAATTTAGGGTACCAGATCTATAGAAGGCATTTTATCTGTAGAACTTTAC
TAGTGATTTGTGTGATATTGGAGAAAATGGCCAATCTATCATACATTAGAAAGATCACAT
AAGTCTTCATCTATGTGTTCTGTGATCTATAAAACGTGTTATTACTTCCAAGAAATTTTC
TGTTTCAGTGGGAAAGGCCTCAATCCACCCATTTTGGGCGTCTATGCAAGCCAGGAGAAA
CTTGAATCTCAGGCAAGGTGGTGGATATGTACAATCAAATTACTACTTTTTTCTGGGGTA
CATGCCTTATTAACAGGCGAAAGTAAGGAGTGGCAAAAGTTATAAGTGGCCTTCAGGATT
ACAGGATTAGATTTAGCTTGATAATATATAATAGCTTTGTAAAAGATTACCACCAGCAGT
CAATCTTGCTTTCATATACATCCGCCTTCGCGATTAACCTACTTCCTTTAACTTTGTTCT
TTTGGAAAAGTATTATATTGTTTTTATTTGGGTGGGTGATTTGGGCTACACCCAGCAGTG
CTCAGAGATCATTCCTGACTCTGTGCTCAGGAATCACTCCTAAGAGTGTTCACTGGGACT
ATACATGGTGCTGAGGATAGAGCCAAGGTCAGCTACAGGCAAGGCAAGAGCCTTAGCCTC
TATACTCTCTCTCCAGCCCTCTTGTTCAATCTTCTGCATCTTTGTATTTTATTTTCAAGA
TTAATAAATGATTTTATGATATATCATTAGTTCATTTTATTATTGACATCAGAATCATAA
TTCTGTTGATGTACATTTGATTGTGCTCCAGTGTGATGTTATTATATGAGATACTGATCC
AAACATGGTTGAGCGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved