Sorex_araneus Locus Mono:115:SNORA46
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:115:SNORA46
Sorex_araneus
Mono:115:SNORA46
scaffold_135099
SNORA46
1001..1135
2135
ACTAGGTCCATTCTAAACCATACCATTCATTGTTCATTCCCTTCTGTTTAAATTTGACT
GGGGCCTTATCATTATATCATAATCTTTCCAAGTCTTTATTTCCTTACTTGCAGAGAGAG
AGGGACATGTGTACTTGCAGCTCAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTTGGAGAGTAAGTTTTGAGATGGAAAATGGCTGGGGACGATATGAAGATAAAGGA
CTAGCCCAGTCTCTCTATCCTGTGCGTTGAGAAGGAATGGAAGGGAGAGATGGGAGATTG
GAGAGGACGTTTGGCTGTCTATAAACATGTTCCTACCTGCTCTTTCATGCTGGAAGTTTT
ATGATAACAAATTCTCACACAAGGAGGCCTTGATTTTTCAGGCTGACATATATCTACCCC
TAGGATTCATTGATAAAAGCCTCATTGTTGTTGTATAGGTAAACCAGCTTCTCCAATAGG
AGGTTAATCAGAAGTAGACATGATCTTTGTATTCCCTTCTACTAAGCTGATTATGAACAT
GTGTATGAAGAATAGCATTTTAAAAAACATTCTGTTTTGATATTATCTTCAGCAATCTTC
TAGCTTATGTCAGAGAGTGACACCATTCAAGGGCATTGTGTGTCTGTTACCCTGCTTTGA
CAAAAGTGCCTTCCATATGGCTTCAGAGGTTCAGATCCGAGGAAGTCACCAGAAACTGAT
GCTGTGTGATCTTATTTTATGAAGCTTTTTGACTCGGAGTCTTCTCTTTATTTAAACCAA
AGTATGGGACTCTTCCCCATTCTTGGTTACTCTATAGTGCAAACGAATTCCTGGCTCTCC
ATGCACGGCTGACTTTCTGCCATTCTGCTGTTGCGATATTGAGTTAAGGAACATGTCTGT
ATTGTTATCAGCCTTTATTATCTGATAGTAGGAATGACCATTTGTCTATATAGGGACTAA
AGTTGTCAGGGCTTTTAAAATAAAAATTTTTTTAAATACCTGGTGGTTCTTAGGGCTACT
TCTTGTTTAGTACTCAGGGTTCACTCCTTGTGGGACCTTGGCAGTACCCTGGGGCAAAGC
TTTTGCTCACCCCATTGAACTGTGTCTGGCCCTAAAATGTGTGGGTCTTAACACATTAGA
TTGTTGAGTTGAATTGAATTCATCAAGACTTTTGTAACTCAATTGTCTTAGGTCTAGGTA
AAGTTTTCACCTTTTGGTGTTTTGTTTTTACCACATCAAGTATTGCTCAGGATTTACCTC
TGACTTTATGCTCAGGGATCATTTCTGGCATGCTTGGCGGGGGGTATCATATAGGGTGCC
AGGGATTGAACCTCGGTTGGCCGAGTACAAGGCAAATGCCCAACCTGTTGCAGTATTGAT
TTGGCCCCCAAGTATTTGCATTTTGAAATACTTTTTAGTGGGATTATAGACAACTAGTAA
TTATGGGGACTGTAATCATGGAGTGATAGCACAGTGGGTAGGGTGTTTACCTTGCATGTG
GCTGACCCAGGTTCGATTCCTCCCGTCCCTCTCAGAGAGCCCGGCAAGCTACTGAGAGTA
TGGAGCCCGCATGGCAGAGCCTGGCAAGCTTCCCGTGGCATATTCGATATGCCAAAAACA
GTAACAACAAGTCTCACAATGGAGATGTTACTGGTGCCCGCTCAAGCAAATCGATGAACA
ACGGGACTACAGTGCTACAGTGCTACAATCTTCTCTTACGTTTCCCCTGCCTTGCCAACA
ACATTGACCTGTGAGAAACATGCCTGTTCTGCTTTTTTTTCCGTCATATTCATTTCACTT
AAGTATCCCTTCCCATTCTTCTCCTTCTTCTCCAACTGACAAGATGGAATGTAGTGAGAA
ACAAAAGCTGTCAGCTTTGAGTGATGATTAAATGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved