Sorex_araneus Locus Mono:602:SNORA26
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:602:SNORA26
Sorex_araneus
Mono:602:SNORA26
scaffold_234454
SNORA26
1001..1119
2119
AATTAATTACTTGTTTGAGTTCACTAAACAATAGAAATTTCCTTCTCCCGTTTTTATAA
TCTTCTTAGATACATTTTTTCCATATAATTTAAGAAAGTGTTAATAGAAACAAGTAACCA
TATAATTTAAAGGTAGGTCTGGAAGGACAATTACATGGGTTTATTTTTAAGCCACACAGT
GCATACTCTCGGATAATCAAGCAACCATCCGGAAAGATTTTCAGGACAGAATTCTTTCAT
CAATAAATGTAAGACTGTGCTAAGATCATTTGGTCGCCCTGGCATACACATATGACACAT
GGATGAACTTTTCTCTAATTCCAATTGTGCACAATTGCTGTAACCTCATAAAGGCCTCAT
TTTGATCCAGTTTCTCACTGCTGTTAAGTATAGTATTGAAGATTCCAGTCAGTTCAGTTA
AGATAGAAAAAGAAAGCAGACAGGCTATATGGAAAGACATAAAGGTCTTTCTTCATAAAA
TAAAAAATGATCCTCATTAAAAGTTCCCATGAGAGGGTCTGGGAAGGTATCTCATGGTAC
AGAGCATCTTTGCATGTGTTAGGCCTTGGATTTGGCTGCTTGCACTGCAAAAGATAAAAT
TAAATAAACAAAAATTTAGGCACAACCCCATTCTAGGGTTGTTCACACAATATTGTAGGA
GGTATTAAATTCCTCTATTTTACTTTTTGGGGTGAGAATTCTCTCCTTCTAATAGAGCCT
ACGTTCATTCTGTCTCTCGATTTTTTTCTCATATTCCCTAAACAAAAATATTTTAAATAC
TAAATACACATTTAATATGCATATATTATAAATAAATAATAAATTAAAGTCCCAGGAATC
TCATTAGAAGCTCTTAGAATCTAAAAGTGAGCTTAGAAACTAGAAAAGATAACATGGTTA
ACATAATGAACATCAATTATACTTTTACAGAATAGCAACAATAATTAGAAAATAGATTTT
AATAAACAAAACTTAAAATAGGTTTTAAAGAAGATTGCACTGTGTCCTTTTAAGACTGGT
GCAGTGCCTTAAGAGATTAACAGAGAGGGTAAAGGCAGTCTCTGAAAAATTCAGAAAAGA
TTATAAAACTTCTCTTTGAGTGCTTTCTGGAGCTACAGTGGAAATATTTGTATGCACCTG
AAAAAATTCAATGCAGTATTGAAAACAAGTTAAATGCAGATTTTTAAAAATCAAAAGAGA
GCTAAGATAATGGGAGGAAGTGTACATAGCCTGAAAGTCTACATATTTAATATGACAATT
CCACCCTAACGGATATATAGATTGAACACAGACACATCAAACTTCTAGAAAAATTCAAAA
GTTTATATGAGAAGACAAAGCAACAGGAGTGACCAAAAATGTGGTGGAAAATAAAGAACA
CTAGAGAACTCATATTATTTGAAGATTAACTATAAAGTTACAATAATCATGAGTGTGTGA
TAATGACAAAAGAACAGATACTTAAACCGTGAAATAGAATGGGGACCAGATACATATTTG
CACATTTAATTTCAACAATGATGAAAAGCTCTCTTCAATAAATAACACATAAAAAGTTTG
ACCCTCTTATGCAAAAGTAAACTGGCACCCATATTATGTACTGTAGCACTGGAGCACTGT
TGTCCCGTTGTCCATCGATTTTCTCGAGCGGGCACCAGTAACATCTCCATTGTGAGACTT
GTTGCTATTGTTTTTGGCATATCAATACGACACAGGTAGCTCGATGGGCTCTCCAAGAGG
GACAGAAGAATCAAACCTGGGTCAGCCGCATGCAAGGAAAATGCCCTACCCACTGTGCTA
TCGCTCCAGTCCATCACTGTCACTGTCACTGTCATCCAGTTGCTCATCAATTAGTTCGAG
CGGGCACCAGTAACGTCTCTCATTTAGGCATATCGAATATGCCATGGGTAACTTGCCAGG
CTCTGTCGTGCGAGCTCGATACTCTCGGTAGCTTGCCAGGCTCTCTGAGAGGGGCAGAGG
AATCGAACATGGGTCGGCCGCGTGATAGGCGAATGCCCTACCGCTGTGCTATTGCTCCAG
CCCCGTCTATCGCTCCAGCCCTGCAACAAAATTTAATTAAAAGTAAACAAAAATAAAATT
CTGTAAAAAAAGATGTAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved