Sorex_araneus Locus Poly:2:SNORD25
snOPY snoRNA Orthological Gene Database
Sorex_araneus Poly:2:SNORD25
Sorex_araneus
Poly:2:SNORD25
scaffold_150444
SNORD25, SNORD26, SNORD28, SNORD29
1001..1070, 1228..1305, 1874..1945, 2119..2185
2299
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCCCCCCCCGTCCCGTGAGCCTTTGGGAAACGATATTTAAGCATCTC
GCGGCGTTCGTGGTCTCATTTCTCCTCTGTTCTCGGTGAGTGTTTGCGGATCTCGATCTA
GTCGGTGGAACGGGCCTCTTTGCGGGCTTCCCGAGCCCGGTGCCCGCTAGTATCTGGTTG
CGCGGTTTGGTTGGGGACGCGACAGAGGGAAAAAGGTCACGCAGCCCGAGGCTGGGCGGG
GGAGGGGGGCTTTGAGAAACAAAAGGGGCGTGGCGGGCCCCCTTCCCCGTGATGAGACGG
TTTTCACAGACCTGTACTGAGTTCCGTGAGGATGGAAAGCTCTGAGGAGATGGGCCCTGC
TCAAGCCCAGCTCGGGAAATGTGCCTTTACCGGGCGCCCGGTTCTGAACTCGATCCCTTC
TCATCTTGCAGGTGGCGGGCGCTGGAACGTGGGCGCCGAGGCCCGGCCGAGTAAGTGCGG
ACGGGTTTCGATGCCCCTCGTGAGCGTGCTGCGGGGATGATTCTGACCCTTGAACTCTCT
CTTGCTGATGGGCCAGTGGAGAAAAATCCTCAAAGTTCTGAGTGGCACCTCCGTAGACCT
TAGTACCGCTACCGCGTTGCATGGAGCTCAGAGCCTACAACTAAGGGCGATCGCTGGGTT
GTGTCTTTATTTCTAGTCTCGATCAAGCGCAGGAGAACGGCACAGTTGCAGGATGGGACG
AGGAGCACCCAGCTGCCGATGCAGCGTTACTGGGAGAGGCCAGGTACGTGTGGGAAAGGG
GCGCGGGGCTTCCGTGGCGCGCGACCACTCCGTGATGAACGTAAAATGACAAGCATATGG
CTGAACCGAAGTGATGTCATACTAGGTGCTGAGAAGTGGGTCGGGAGCGCACGGGGCTTT
CGGGATGGCTGCTAATGCAGGTGCATAGAATTCTTTTTCTTTTTGTCTCCAGCATCTTGT
GGTCAGCCATGAGGAATTCCGCTGCCCGGCCGGGTGAATGCAGGTAATTTCCCCATGGGA
GGTTTGGGGTGTGTTATTTCCCAGAGAACAAATGGCCCGTGGAGCAACATTGCTCTGGGC
TCCTACCAACTTATTCTTGGCATCATCTTGGGCAACCTAGATAATAAGGCTGGTTGGTTC
TGCCCCAGCTGACTGTCAGATGATTTGAATCGATAATGCTGATCCTCTGTGAGGTACAAT
AATAGCATGTTAGAGTTCTGATGACGGTTAGTTATTGAAGAAGCCTTACTGGGCTCCAGC
GTCCACGAGCAACAGTTTGTTTTTCTTCCTGCAGCTTTTCTGGACGATGCTGCATTTATA
AGGTATGTGGCCCATCGGGGAAGGACTCTTTGATTACTAAGGGGTTGTTTGTGCTTTTGG
TTTGTCACCAAATGGGCAGTTTCTATGATGATTAAAACTAGCTCACTTTGATTTGCACGA
TGAAAATAAGTGAACACCTGAGGAACTGGTTGAGGACATAGTTGGGGCAGTGCTATGCTT
GCCTAGGTAACGTGCATCAACTTTCTTTTCCCTCCGCTAGGCCCCATTGGGTACTGATCT
GCCTGTTGCTCAAAGTGAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved