Sorex_araneus Locus Mono:524:SNORA49
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:524:SNORA49
Sorex_araneus
Mono:524:SNORA49
scaffold_233854
SNORA49
1001..1138
2138
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AGGGGTTACTCTTGGCTCATGCACTCAGGAATTACTCCTGGTGGTGCTCTGGGGACCATA
TGGGATGCTGAGAATCCAACTTGGGTCGGCTGCTTGCAAGGCAAACGCCCTACCCAATGT
GCTATCACTCCAGCCCCTCTTTTTGTATTTTATACCTTTATACTAGCTTATAAGTGATCA
ATCTGCCACCTTCACATTAAATCAGTTTGACTTTTTTTCTACTTGTATCACTGATTTATA
CTTGCAGCTTTTCCTGTTGCTAGTGTCCATTTCTTTCACCTTAAAAAAATCCTCTAACAT
TTCTTATAAGCTCAGATTAGTGGCAATGAAATCTTTTACCTTTCCCTCATCTAAATTCTA
TCCCAGGGGCTTTTTGCCTGTAGAGTGCTCTGGCATTACCTGAGGGTAATGTGTGGGAAA
AGTGCAATTCCCTTCCAGGAAGACTATTTCTATTTGGGCCTACAAGGTGAGTTGACAGTC
AAAAACAAAACAAACAAAAAACTCTGCCTCTTTTTAATTGAGGTGAAAACTGTATGGTGA
AACTTCGTGGTGAAAAGTTTTCCTTGTAGAGAATTCTTGTTTTTCAGTACTTTTAATAGA
ATATATATTATATATTTATAATACATAATAATTTATATTATATATTATAATAATTTATAA
TATATTTAATATGTCATGCCCATGTTATAAATACCTGATCATCTTTATAGGAGGTACGAG
GAAGATTCTCTTAGTCTCACACATAGCAAGTTGTTTTTCTGTCAGTAATTTCCACCTTGT
CTTTAACTCTTGACACTTTAATTGTTATGTGTCAGTGCGTGGATCACTTGGGTTCATTTT
ATATGAAAATCTCTGAATATGCATGTTTGTTTCTGTCCCAAGTTGGGGAAGTATTTTTAG
TCACTATTTCTTCAAATTAGTCTTGTGTTTCACACTCTTTTCACCTACCAGTGCCAAATA
AGGCAAACAGTGTTCTGCTTTTTGCAGAAATCCCTTCAATTATTCTCATGTATTTCATTA
TTATTATTATTTTTTTTTGCTGCTACTTGGGTGAGTCCAGTGCCCTCTCTTCAACTTGGC
TGATCCTTTCTTTAGCTTCATCTAATGTGCTGTACAGCACTTCAGTGCATTTTTCAGTAT
TACTGAAATTTTTGATTTCATGTACTTTTGACTATTCTCTCTCTTTTATGAAAATCTCGC
TTTTTTCATCCAGTCTTCTCCTGAGATGGTAAACAGATTTATAACTATTGTTTGAATTTA
TCAGGTAAATAAGTAGTTTATAGGTTCATTGGAATCCACTACTTTTTTCTTCTCTATTTT
TAAGTTTTATCTTACTCTTATTTGGAACACATTGCTGTTTCTTCATTTCCCTTGACTACA
CACTTTGTTGGTTGTGTCCCCTACACTGGAGAGAATAGTCTGCTTTCCAGGTTTTGAATT
AGTTAGGGGCCTCATATAAATTAATCCTATTGTTCTATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved