Sorex_araneus Locus Mono:416:SNORD18
snOPY snoRNA Orthological Gene Database
Sorex_araneus Mono:416:SNORD18
Sorex_araneus
Mono:416:SNORD18
scaffold_203673
SNORD18
1001..1070
2070
GATTCATTTGATTACACTTCTAGCACCTTATTTAATTGAGCCGACTTCCTTTCTTACAT
AGGAGATATAAATAAGAGATTAACTGTTGGGATGGGAAAAGTGAGTGAGTAGGAGCTAAG
CATTTTGGAATATCAAAATAATTTAATTGGATCCCAAATGAATTAAGATGTGTGGGAGTC
CAAATTATACCCCAAATACCAAGTCTGCATAAAGCTAATTTAAAAATAATTTAAGTGAAC
TAAATAGAATGACTGTCTTATGCTAAAAAAATTGCAGTGAATATACTGAAAAGAATTTTA
TTCACATTAAATCATAGTCATTAAACTTGTATTTCAATAAGGAATCTTGTTGAAGTTAGA
ATCAATTTGAAGTATAAAAAATGACAGATACCTATAACTAATTTGAAATACATTGTATTA
CTGGAGAGAGAATAAATCTGTTAGTTTTGTTCATTTTAATGATCATCATATTTCCAAAGG
TGACACTTTTACCAAGAAATAGGTGTATGCTCTTAAAATGATACCTAGAGAATACTTTCT
ACAAAATAGTGAGTTTGTACCTTCTGTTTGTTAAATTTCAATCTAGAAGGACACAGTCAG
TTCCATTTTTTTTACTCCTTTTTCTTTTTCCCCTTTCCTGCTTTCCAAATTTTCAACATT
CTTAGTTGTGTTCTCTAGGAAACTCAGTAAATCATCCCTTTGCTCTTACCCCCCAAAAAG
TTCTATCACTTTTTCTCTCTTTAATCCAATTGATGTGGCTTTTACTCCTTCCTTGGAAGG
TAACTGGTAATCTGAGTTTAAATCTCAAATGCATTATTATACATTGTGAAATGTTTTCTA
TAATAATAACTAATATCCAAGATTGTGGTAAATGAGTAACATGTGCAGTTGAAGGAAACA
TGCTATTGTGCAATTTACCTGGGAGAGAAATGGGGAGAATAGGAAAAGAACAAAATGATA
TTTGGATTTCCATCACTCAATCTGGGTTGCTTGCTCTTCTGATTGGATGTTAAGATCATC
TTTCAGTACCGTGTTTCTGAAACTTAAATAATTATAGACTTTTCTAAGTAAGATTTTAAT
GTGCTTCTCCAGAGATCAGAGCAATCTTGAGGCTGGAATCAACTCGTCTCTTATGTAAAT
GTTACCAAGTATTCTCAGCTTGGGCTTCAAAATAAGGTCCAGGAGATGATNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved